Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU110401

Sigma-Aldrich

MISSION® esiRNA

targeting human IDH1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTGCAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGACAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAGCTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAGGCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiayi Liu et al.
Journal of cellular physiology, 234(7), 11602-11609 (2018-11-30)
DDIT3 is of great importance in endoplasmic reticulum stress and is involved in many inflammatory diseases and mineralization processes. The cementum protects teeth from periodontitis and provides attachment for Sharpey's fibers of the periodontal ligament. However, the effect of DDIT3
Daniel R Wahl et al.
Cancer research, 77(4), 960-970 (2016-12-08)
NADPH is a critical reductant needed in cancer cells to fuel the biosynthesis of deoxynucleotides and antioxidants and to sustain stress-survival responses after radiation-induced DNA damage. Thus, one rational strategy to attack cancer cells is to target their heavy reliance
Qi Wang et al.
Oncology reports, 43(1), 188-200 (2019-11-21)
Mutation of the isocitrate dehydrogenase (IDH) gene is regarded a novel indicator for the prognosis of patients with glioma. However, the role of the IDH1 gene mutations in carcinogenesis and the mechanisms underlying their function in glioblastoma multiforme (GBM) remain
Chan Chung et al.
Cancer cell, 38(3), 334-349 (2020-08-17)
H3K27M diffuse intrinsic pontine gliomas (DIPGs) are fatal and lack treatments. They mainly harbor H3.3K27M mutations resulting in H3K27me3 reduction. Integrated analysis in H3.3K27M cells, tumors, and in vivo imaging in patients showed enhanced glycolysis, glutaminolysis, and tricarboxylic acid cycle metabolism

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service