Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU109271

Sigma-Aldrich

MISSION® esiRNA

targeting human PDIA3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCTGGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAGGAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAATCTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTAGTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAATTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGCGAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jialing Wu et al.
Virology journal, 17(1), 55-55 (2020-04-23)
Hemagglutinin (HA), as the surface immunogenic protein, is the most important component of influenza viruses. Previous studies showed that the stability of HA was significant for HA's immunogenicity, and many efforts have been made to stabilize the expressed HA proteins.
Min Ho Choe et al.
Oncotarget, 6(5), 2654-2666 (2015-01-22)
Although targeting radioresistant tumor cells is essential for enhancing the efficacy of radiotherapy, the signals activated in resistant tumors are still unclear. This study shows that ERp57 contributes to radioresistance of laryngeal cancer by activating STAT3. Increased ERp57 was associated
Takamasa Inoue et al.
Journal of virology, 89(17), 8897-8908 (2015-06-19)
The nonenveloped polyomavirus (PyV) simian virus 40 (SV40) traffics from the cell surface to the endoplasmic reticulum (ER), where it penetrates the ER membrane to reach the cytosol before mobilizing into the nucleus to cause infection. Prior to ER membrane

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service