Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU107851

Sigma-Aldrich

MISSION® esiRNA

targeting human SSB

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCAAGGCAGAACTCATGGAAATCAGTGAAGATAAAACTAAAATCAGAAGGTCTCCAAGCAAACCCCTACCTGAAGTGACTGATGAGTATAAAAATGATGTAAAAAACAGATCTGTTTATATTAAAGGCTTCCCAACTGATGCAACTCTTGATGACATAAAAGAATGGTTAGAAGATAAAGGTCAAGTACTAAATATTCAGATGAGAAGAACATTGCATAAAGCATTTAAGGGATCAATTTTTGTTGTGTTTGATAGCATTGAATCTGCTAAGAAATTTGTAGAGACCCCTGGCCAGAAGTACAAAGAAACAGACCTGCTAATACTTTTCAAGGACGATTACTTTGCCAAAAAAAATGAAGAAAGAAAACAAAATAAAGTGGAAGCTAAATTAAGAGCTAAACAGGAGCAAGAAGCAAAACAAAAGTTAGAAGAAGATGCTGAAATGAAATCTCTAGAAGAAAAGATTGGATGCTTGCTGAAATTTTCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Adam J Pollak et al.
Nucleic acid therapeutics, 30(5), 312-324 (2020-06-27)
In this study, we demonstrate that 5S ribosomal RNA (rRNA), a highly structured and protein-bound RNA, is quite difficult to reduce with antisense oligonucleotides (ASOs). However, we found a single accessible site that was targetable with a high-affinity complementary ASO.
Elsa Patricia Rondon et al.
International journal of nanomedicine, 15, 6183-6200 (2020-09-15)
Diethylaminoethyl-chitosan (DEAE-CH) is a derivative with excellent potential as a delivery vector for gene therapy applications. The aim of this study is to evaluate its toxicological profile for potential future clinical applications. An endotoxin-free chitosan (CH) modified with DEAE, folic
Radu Mihaila et al.
Molecular therapy. Nucleic acids, 7, 246-255 (2017-06-19)
Lipid nanoparticles (LNPs) have been used to successfully deliver small interfering RNAs (siRNAs) to target cells in both preclinical and clinical studies and currently are the leading systems for in vivo delivery. Here, we propose the use of an ordinary differential

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service