Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU106231

Sigma-Aldrich

MISSION® esiRNA

targeting human PGD

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGTTCCAAGACACCGATGGCAAACACCTGCTGCCAAAGATCAGGGACAGCGCGGGGCAGAAGGGCACAGGGAAGTGGACCGCCATCTCCGCCCTGGAATACGGCGTACCCGTCACCCTCATTGGAGAAGCTGTCTTTGCTCGGTGCTTATCATCTCTGAAGGATGAGAGAATTCAAGCTAGCAAAAAGCTGAAGGGTCCCCAGAAGTTCCAGTTTGATGGTGATAAGAAATCATTCCTGGAGGACATTCGGAAGGCACTCTACGCTTCCAAGATCATCTCTTACGCTCAAGGCTTTATGCTGCTAAGGCAGGCAGCCACCGAGTTTGGCTGGACTCTCAATTATGGTGGCATCGCCCTGATGTGGAGAGGGGGCTGCATCATTAGAAGTGTATTCCTAGGAAAGATAAAGGATGCATTTGATCGAAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoyu Yang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 20(9), 1145-1152 (2018-01-18)
6-phosphogluconate dehydrogenase (6PGD), a key enzyme of the oxidative pentose phosphate pathway, is involved in tumor growth and metabolism. Although high 6PGD activity has been shown to be associated with poor prognosis, its role and therapeutic value in breast cancer
Jun Cao et al.
The American journal of the medical sciences, 360(3), 279-286 (2020-08-25)
The essential role of 6-phosphogluconate dehydrogenase (6PGD), the enzyme catalyzing the oxidative pentose phosphate pathway, in tumor growth and metabolism has garnered attention in recent years. In this work, we are the first to demonstrate that aberrant activation of 6PGD
Wujian Zheng et al.
Frontiers in pharmacology, 8, 421-421 (2017-07-18)
Cisplatin (DDP) is currently one of the most commonly used chemotherapeutic drugs for treating ovarian and lung cancer. However, resistance to cisplatin is common and it often leads to therapy failure. In addition, the precise mechanism of cisplatin resistance is

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service