Select a Size
$220.00
Notify Me
Get notified when this item is ready to ship via email.
Select a Size
About This Item
$220.00
Notify Me
Get notified when this item is ready to ship via email.
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGACGAGGACGATGACTTGTGGGTGGAGCTTCGCCACATGCATATCGCAGATGTGTCCAAGAAGGTCACGGAGCTCCTGAGGACCTTCTGTGAGAGCAAGAGGCTGACCACGGACAAGGCGAACATCAAAGACCTATCCCAGATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAATAAGTATTCTACGCACCTGCATCTAGCAGATGATTGTATGAAGCACTTCAAGGGCTCGGTGGAGAAGCTGTGTAGTGTGGAGCAGGACCTGGCCATGGGCTCCGACGCAGAGGGGGAGAAGATCAAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... STXBP2(6813) , STXBP2(6813)
Related Categories
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service