Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU099201

Sigma-Aldrich

MISSION® esiRNA

targeting human EDA2R

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCTCGCAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGTGTTCAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGAAAGACACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAGGTTCAATGTGCCTTCCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mi Hee Kwack et al.
Biochemical and biophysical research communications, 529(3), 766-772 (2020-08-02)
Androgenetic alopecia (AGA) is a common genetic disorder, and a X-chromosomal locus that contains the androgen receptor (AR) and ectodysplasin A2 receptor (EDA2R) genes represents a major susceptibility locus for AGA. In our previous study, we reported that ectodysplasin-A2 (EDA-A2)
Margherita Sisto et al.
Clinical and experimental medicine, 17(1), 111-119 (2015-12-15)
Despite recent advancements in the knowledge of the etiology and pathogenic mechanisms, treatment of the autoimmune disease Sjögren's syndrome (SS) remains mostly empiric and symptom-based, indicating the need for novel therapeutic approaches. Ectodysplasin-A2 (EDA-A2) is a recently isolated member of
Xiqian Lan et al.
Biochimie, 174, 74-83 (2020-04-19)
EDA2R is a member of the large family of tumor necrosis factor receptor (TNFR). Previous studies suggested that EDA2R expression might be increased in the kidneys of diabetic mice. However, its mRNA and protein expression in kidneys were not analyzed;

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service