Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU097671

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACAACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACCGAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGATTCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGCTATTAAGAAAGCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiang Wang et al.
Small (Weinheim an der Bergstrasse, Germany), 16(21), e2000528-e2000528 (2020-04-28)
The mononuclear phagocyte system in the liver is a frequent target for nanoparticles (NPs). A toxicological profiling of metal-based NPs is performed in Kupffer cell (KC) and hepatocyte cell lines. Sixteen NPs are provided by the Nanomaterial Health Implications Research
Vahid Mirshafiee et al.
ACS nano, 12(4), 3836-3852 (2018-03-16)
The liver and the mononuclear phagocyte system are a frequent target for engineered nanomaterials, either as a result of particle uptake and spread from primary exposure sites or systemic administration of therapeutic and imaging nanoparticles. In this study, we performed
Weigang Zhang et al.
The Journal of pathology, 241(3), 392-404 (2016-11-20)
Psoriasis is an autoimmune skin disease, in which keratinocytes play a crucial pathogenic role. High-mobility group protein B1 (HMGB1) is an inflammatory factor that can be released from keratinocyte nuclei in psoriatic lesions. We aimed to investigate the proinflammatory effect
Tianhao Huang et al.
Cell death & disease, 8(4), e2726-e2726 (2017-04-07)
Non-small-cell lung cancer (NSCLC) is one of the leading causes of cancer-related death worldwide. Although epigenetic deregulation is known to be important for tumor progression, the molecular mechanisms in NSCLC remain unclear. Here, we found that G9A (known as EHMT2)
Jason-Alexander Hörauf et al.
International journal of molecular sciences, 21(9) (2020-05-06)
This paper discusses how the assembly of pro-caspase-1 and apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC) in macromolecular protein complexes, inflammasomes, activates caspase-1. The present study investigates the molecular mechanisms of inflammasome activation in HepG2 cells and examines how

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service