Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU097461

Sigma-Aldrich

MISSION® esiRNA

targeting human ICMT

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTTTGGCCAGAACTGAAGCAGATTACCTGGCTCAGTGTCACAGGGCTGCTGATGGTGGTCTTCGGAGAATGTCTGAGGAAGGCGGCCATGTTTACAGCTGGCTCCAATTTCAACCACGTGGTACAGAATGAAAAATCAGATACACATACTCTGGTGACCAGTGGAGTGTACGCTTGGTTTCGGCATCCTTCTTACGTCGGGTGGTTTTACTGGAGTATTGGAACTCAGGTGATGCTGTGTAACCCCATCTGCGGCGTCAGCTATGCCCTGACAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yongbo Zhu et al.
Biochemical and biophysical research communications, 516(3), 784-789 (2019-06-30)
Development of chemo-resistance in nasopharyngeal carcinoma (NPC) poses the therapeutic challenge and its mechanisms are still poorly understood. In this work, we demonstrate that targeting isoprenylcysteine carboxylmethyltransferase (Icmt) is a therapeutic strategy to overcome NPC chemo-resistance. We found that Icmt
Qiong Liu et al.
Biochemical and biophysical research communications, 501(2), 556-562 (2018-05-11)
Inhibition of isoprenylcysteine carboxylmethyltransferase (Icmt), which catalyzes the final step of oncoproteins' prenylation, targets growth and survival of various cancers. In this work, we systematically studied the expression, functions and molecular signaling of Icmt in ovarian cancer. We show that
Woo Seok Yang et al.
Cells, 9(5) (2020-05-20)
In this study, we investigated the functional role of isoprenylcysteine carboxyl methyltransferase (ICMT) and its methylatable substrate Ras in Toll-like receptor (TLR)-activated macrophages and in mouse inflammatory disease conditions. ICMT and RAS expressions were strongly increased in macrophages under the

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service