Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU089731

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACCAGGAAGTCCATTTCAGCTCCCAGCTGATACGCCTCCTCCTGCCTATATGCCACCTGATGATCAGATGGGTCAAGATAATTCCCAGCCTATGGATACAAGCAATAATATGATTCCTCAGATTATGCCCAGTATATCCAGCAGGGATGTTCAGCCTGTTGCCTATGAAGAGCCTAAACATTGGTGTTCAATAGTCTACTATGAATTAAACAATCGTGTTGGAGAAGCTTTTCATGCATCTTCTACTAGTGTGTTAGTAGATGGATTCACAGATCCTTCAAATAACAAAAGTAGATTCTGCTTGGGTTTGTTGTCAAATGTTAATCGTAATTCGACAATTGAAAACACTAGGCGACATATTGGAAAAGGTGTTCATCTGTACTATGTTGGTGGAGAGGTGTATGCGGAATGCCTCAGTGACAGCAG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mateusz Opyrchal et al.
Oncotarget, 8(53), 91803-91816 (2017-12-07)
Although the majority of breast cancers initially respond to the cytotoxic effects of chemotherapeutic agents, most breast cancer patients experience tumor relapse and ultimately die because of drug resistance. Breast cancer cells undergoing epithelial to mesenchymal transition (EMT) acquire a
Moyuan Deng et al.
Cell and tissue research, 361(3), 723-731 (2015-04-07)
Local application of bone morphogenetic protein 2 (BMP2) is known to promote large bone defect healing and BMP2-initiated bone regeneration could be enhanced by an additional mechanical stimulation. The C-terminal 24-a.a. peptide of mechano growth factor (MGF24E), a mechanical-sensitive molecule
Linda T Doan et al.
PloS one, 7(9), e44009-e44009 (2012-09-18)
Insights into Bone morphogenetic protein (Bmp) functions during forebrain development have been limited by a lack of Bmp signaling readouts. Here we used a novel Bmp signaling reporter ("BRE-gal" mice) to study Bmp signaling in the dorsal telencephalon. At early
Mingyue Nie et al.
Biology of reproduction, 93(4), 98-98 (2015-09-25)
In mammals, follicular atresia can be partially triggered by granulosa cell apoptosis. However, very little is known about the functions of miRNAs in granulosa cell apoptosis. We previously reported that hsa-mir-23a (miR-23a) and hsa-mir-27a (miR-27a) were highly expressed in the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service