Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU089381

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGGAGCTGGATGGATGACTACGATTACGTCCACCTACAGGGTAAGGAGGAGTTTGAGAGGCAACAGAAAGAGCTATTGGAAAAAGAGAATATCATGAAACAGAACAAGATGCAGCTGGAACATCATCAGCTGAGCCAGTTCCAGCTGTTGGAACAAGAGATTACAAAGCCCGTGGAGAATGACATCTCGAAGTGGAAGCCCTCTCAGAGCCTACCCACCACAAACAGTGGCGTGAGTGCTCAGGATCGGCAGTTGCTGTGCTTCTACTATGACCAATGTGAGACCCATTTCATTTCCCTTCTCAACGCCATTGACGCACTCTTCAGTTGTGTCAGCTCAGCCCAGCCCCCGCGAATCTTCGTGGCACACAGCAAGTTTGTCATCCTCAGTGCACACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiling Tang
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 782-786 (2018-07-14)
To investigate the effects of human enhancer of filamentation 1 (HEF1) gene on the proliferation, invasion and metastasis of bladder cancer cells. Three human bladder cancer cell lines (T24, EJ and BIU-87) were selected to extract total RNA at logarithmic
Nosheen Akhtar et al.
Molecular carcinogenesis, 57(5), 653-663 (2018-02-14)
Epithelial-to-mesenchymal transition (EMT) plays a crucial role in prostate cancer (PCa) metastasis. This has led to a surge in the efforts for identification of safer and more effective compounds which can modulate EMT and consequently inhibiting migration and invasion of
Yaoping Liu et al.
Genome research, 25(5), 679-689 (2015-04-11)
Candida albicans, the major invasive fungal pathogen of humans, can cause both debilitating mucosal infections and fatal invasive infections. Understanding the complex nature of the host-pathogen interaction in each of these contexts is essential to developing desperately needed therapies to
Peng Lu et al.
Oncology reports, 33(5), 2375-2383 (2015-03-31)
Neural precursor cell expressed, developmentally downregulated 9 (NEDD9) plays an integral role in natural and pathological cell biology. Overexpression of NEDD9 protein has been correlated with poor prognosis in various types of cancer. However, few available data address the precise

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service