Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU088281

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP2K3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGAACTCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGTTTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACAATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cheng-Fang Tsai et al.
Toxicology and applied pharmacology, 338, 182-190 (2017-11-29)
Connexins are widely supported as tumor suppressors due to their downregulation in cancers, nevertheless, more recent evidence suggests roles for connexins in facilitating tumor progression in later stages, including metastasis. One of the key factors regulating the expression, modification, stability
Feng He et al.
Journal of translational medicine, 17(1), 335-335 (2019-10-06)
The P38 mitogen-activated protein kinase (MAPK) pathway plays an essential role in CVB3-induced diseases. We previously demonstrated microRNA-21 has potential inhibitory effect on the MAP2K3 which locates upstream of P38 MAPK and was upregulated in mouse hearts upon CVB3 infection.
Jing Wang et al.
Cell transplantation, 29, 963689720938023-963689720938023 (2020-07-02)
Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease. New evidence suggested that linc02381 suppressed colorectal cancer progression by regulating PI3 K signaling pathway, but the role of linc02381 in other diseases, such as RA, remains unclear. This study aimed
Chien-Hsing Lee et al.
Oncotarget, 8(29), 47425-47439 (2017-05-26)
Alpha-mangostin, a natural xanthonoid, has been reported to possess the anti-cancer property in various types of human cancer. However, its effects and mechanism of α-mangostin in cervical cancer remain unclear. We found that α-mangostin effectively inhibited cell viability, resulted in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service