Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU088051

Sigma-Aldrich

MISSION® esiRNA

targeting human GRB7

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGTCTCGATGCACACACTGGTATATCCCATGAAGACCTCATCCAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAGCTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGCCTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGATGTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACTGACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATCTTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAGTACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jovana R Gotovac et al.
The Journal of pathology, 252(3), 317-329 (2020-08-02)
Efficacious therapeutic approaches are urgently needed to improve outcomes in patients with oesophageal adenocarcinoma (OAC). However, oncogenic drivers amenable to targeted therapy are limited and their functional characterisation is essential. Among few targeted therapies available, anti-human epidermal growth factor receptor
Hong-Bing Zhao et al.
Pathology, research and practice, 213(9), 1180-1184 (2017-08-07)
Growth factor receptor bound protein-7 (Grb7) is a multi-domain adaptor protein that is co-opted by numerous tyrosine kinases involved in various cellular signaling. The objective of this study was to investigate the expression of Grb7 and its clinicopathological significance in
Kangmei Chen et al.
Theranostics, 8(2), 423-436 (2018-01-02)
Human growth factor receptor-bound protein-7 (GRB7) is a pivotal mediator involved in receptor tyrosine kinase signaling and governing diverse cellular processes. Aberrant upregulation of GRB7 is frequently associated with the progression of human cancers. However, the molecular mechanisms leading to

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service