Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU085421

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCCTGGCTTCGACTACAAGTTCCTGGAGAAGCCCAAGCGACGGCTGCTGTGCCCACTGTGCGGGAAGCCCATGCGCGAGCCTGTGCAGGTTTCCACCTGCGGCCACCGTTTCTGCGATACCTGCCTGCAGGAGTTCCTCAGTGAAGGAGTCTTCAAGTGCCCTGAGGACCAGCTTCCTCTGGACTATGCCAAGATCTACCCAGACCCGGAGCTGGAAGTACAAGTATTGGGCCTGCCTATCCGCTGCATCCACAGTGAGGAGGGCTGCCGCTGGAGTGGGCCACTACGTCATCTACAGGGCCACCTGAATACCTGCAGCTTCAATGTCATTCCCTGCCCTAATCGCTGCCCCATGAAGCTGAGCCGCCGTGATCTACCTGCACACTTGCAGCATGACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liulin Tang et al.
Human cell, 33(3), 801-809 (2020-05-11)
Endometrial cancer (EC) is one of the most common cancers among females worldwide. Advanced stage patients of EC have poor prognosis. Inevitable side effects and treatment tolerance of chemotherapy for EC remain to be addressed. Our results in this study
EunGi Kim et al.
Scientific reports, 7(1), 8923-8923 (2017-08-23)
Normal fibroblasts surrounding tumor cells play a crucial role in cancer progression through formation of the tumor microenvironment. Because factors secreted from normal fibroblasts can modulate the tumor microenvironment, it is necessary to identify key factors associated with regulation of
Hua-Yan Ren et al.
Oncotarget, 6(6), 4080-4096 (2015-03-05)
Tumor necrosis factor receptor associated factor 4 (TRAF4) is an important adaptor protein that plays a significant role in several signaling pathways. By studying the relationship between TRAF4 and 70 kDa ribosomal protein S6 kinase (p70s6k) in vivo, we demonstrated

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service