Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU081751

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM1L

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me

Get notified when this item is ready to ship via email.

All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTGCCAGGAATGACCAAGGTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGAGAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCTAATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATGGTCGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAGGAGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAA

Ensembl | human accession no.

ENSG00000087470

NCBI accession no.

NM_005690

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DNM1L(10059) , DNM1L(10059)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
AEV
IBV
LVU
FMU
YFT

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Maria Manczak et al.
Human molecular genetics, 28(2), 177-199 (2018-09-22)
The purpose of our study was to better understand the effects of mitochondrial-division inhibitor 1 (Mdivi-1) on mitochondrial fission, mitochondrial biogenesis, electron transport activities and cellular protection. In recent years, researchers have found excessive mitochondrial fragmentation and reduced fusion in
Nicole L Mancini et al.
Cellular and molecular gastroenterology and hepatology, 11(2), 551-571 (2020-09-30)
Adherent-invasive Escherichia coli are implicated in inflammatory bowel disease, and mitochondrial dysfunction has been observed in biopsy specimens from patients with inflammatory bowel disease. As a novel aspect of adherent-invasive E coli-epithelial interaction, we hypothesized that E coli (strain LF82)
Unbin Chae et al.
Bioscience, biotechnology, and biochemistry, 83(3), 409-416 (2018-11-27)
Microglial activation is known to be an important event during innate immunity, but microglial inflammation is also thought to play a role in the etiology of neurodegenerative diseases. Recently, it was reported that autophagy could influence inflammation and activation of
Raja Gopal Reddy Mooli et al.
Journal of cell science, 133(18) (2020-08-28)
Emerging evidence indicates that proper mitochondrial dynamics are critical for adipocyte differentiation and functional thermogenic capacity. We found that the mitochondrial fission protein dynamin-related protein 1 (DRP1, also known as DNML1) is highly expressed in brown adipose tissue compared to
Zuyi Weng et al.
European journal of dermatology : EJD, 30(4), 329-337 (2020-09-25)
The pathogenesis of psoriasis is still not fully understood. Dynamin-related protein 1 (Drp1) regulates mitochondrial fission and is implicated in various inflammatory conditions, but research regarding Drp1 in the skin is scarce. To examine Drp1 expression in psoriasis vulgaris lesional
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service