Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU079681

Sigma-Aldrich

MISSION® esiRNA

targeting human S1PR1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCTCCTCAACGTTCTTTTACTTTATACTTTAACTACCTGAGAGTTATCAGAGCTGGGGTTGTGGAATGATCGATCATCTATAGCAAATAGGCTATGTTGAGTACGTAGGCTGTGGGAAGATGAAGATGGTTTGGAGGTGTAAAACAATGTCCTTCGCTGAGGCCAAAGTTTCCATGTAAGCGGGATCCGTTTTTTGGAATTTGGTTGAAGTCACTTTGATTTCTTTAAAAAACATCTTTTCAATGAAATGTGTTACCATTTCATATCCATTGAAGCCGAAATCTGCATAAGGAAGCCCACTTTATCTAAATGATATTAGCCAGGATCCTTGGTGTCCTAGGAGAAACAGACAAGCAAAACAAAGTGAAAACCGAATGGATTAACTTTTGCAAACCAAGGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Akira Nomachi et al.
PloS one, 8(12), e82590-e82590 (2013-12-21)
The lipid mediator sphingosine 1-phosphate (S1P) regulates a wide range of cellular activities, including vascular maturation, angiogenesis, and immune-cell trafficking. Among the five known receptors for S1P (S1PR1-S1PR5), S1PR1 is a critical regulator of lymphocyte trafficking: its signaling is required
Ting Fang et al.
Frontiers in pharmacology, 11, 529962-529962 (2020-10-27)
Coix Seed Oil (CSO) possesses a wide range of pharmacological activities. Kanglaite Injection, a commercial product of CSO, has been used clinically as an anticancer drug in China for decades. However, its molecular mechanisms on triple-negative breast cancer (TNBC) remains
H-X Wu et al.
European review for medical and pharmacological sciences, 21(1), 108-114 (2017-01-26)
MicroRNAs (miRs) regulate the proliferation and metastasis of numerous cancer cell types. This study aimed to reveal the role of microRNA-542-3p (miR-542-3p) in breast cancer (BC) cell proliferation and its potential mechanisms. MiR-542-3p expression was detected by reverse transcription-polymerase chain
Zhi Zheng et al.
International immunopharmacology, 66, 224-235 (2018-11-27)
Inflammation-induced lymphangiogenesis is a widely accepted concept. However, most of the inflammatory factors and their related mechanisms have not been clarified. It has been reported that sphingosine-1-phosphate (S1P) is not only closely related to the chronic inflammatory process but also
Lan Xiao et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 33(6), 1090-1104 (2018-01-30)
Accumulating evidence indicates that the immune and skeletal systems interact with each other through various regulators during the osteoclastogenic process. Among these regulators, the bioactive lipid sphingosine-1-phosphate (S1P), which is synthesized by sphingosine kinase 1/2 (SPHK1/2), has recently been recognized

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service