Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU075981

Sigma-Aldrich

MISSION® esiRNA

targeting human NECTIN2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGACGAGGGCAACTACACTTGCGAGTTTGCCACCTTCCCCAAGGGGTCCGTCCGAGGGATGACCTGGCTCAGAGTCATAGCCAAGCCCAAGAACCAAGCTGAGGCCCAGAAGGTCACGTTCAGCCAGGACCCTACGACAGTGGCCCTCTGCATCTCCAAAGAGGGCCGCCCACCTGCCCGGATCTCCTGGCTCTCATCCCTGGACTGGGAAGCCAAAGAGACTCAGGTGTCAGGGACCCTGGCCGGAACTGTCACTGTCACCAGCCGCTTCACCTTGGTGCCCTCGGGCCGAGCAGATGGTGTCACGGTCACCTGCAAAGTGGAGCATGAGAGCTTCGAGGAACCAGCCCTGATACCTGTGACCCTCTCTGTACGCTACCCTCCTGAAGTGTCCATCTCCGGCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fabian Wolpert et al.
PloS one, 10(10), e0139603-e0139603 (2015-10-07)
Immunotherapy targeting glioblastoma initiating cells (GIC) is considered a promising strategy. However, GIC are prone to evade immune response and there is a need for potent adjuvants. IFN-β might enhance the immune response and here we define its net effect
Elisabeth Devilard et al.
PloS one, 8(10), e77424-e77424 (2013-10-12)
Lymphocyte trafficking and migration through vascular endothelial cells (ECs) in secondary lymphoid tissues is critical for immune protection. In the present study, we investigate the role of nectin cell adhesion molecules for the migration of lymphocytes through ECs. Nectins are
Benjamin Murter et al.
Cancer immunology research, 7(2), 244-256 (2019-01-20)
A limitation to antitumor immunity is the dysfunction of T cells in the tumor microenvironment, in part due to upregulation of coinhibitory receptors such as PD-1. Here, we describe that poliovirus receptor-related immunoglobulin domain protein (PVRIG) acts as a coinhibitory
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service