Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU074811

Sigma-Aldrich

MISSION® esiRNA

targeting human WHRN

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAGGCCTTCAAGACTAAGGACCGTGACTACATTGACTTTCTGGTCACTGAGTTCAATGTGATGCTCTAGAGGCCAAGGCCTGAGGGCCTCCCACCACTGCCCAGCCCCTGGTCCCAGTCCCTTTCCACCGTTGGCTTCATCAAGCTCCTTGCGGGGTTGGGGCTGCATGGCCAGGGTGGCAGGAAGACATCCCCCCTCCATCCCAGCCCACTGGACCAGAACTGGGAGAGGAAGAGAGCAGGACAAGGCAGACAGAAGGTCAGGTCAGGAACTGGTGCTGTACTGGGTACACAGTAGGCGCCCAGGACAAGTGGGTTGCAAGACAGGAAGAAAGGAAAAGGAAGGGCAGAGTGCTGGTTTCTCCAGGTTGGGTTGGGGGCACTGCTGTCCCCCCTCCAGCTAGGACCCAGCCCATCCCCAGATGCCTGAGCCTTTGTCCAAAGTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fernanda C Teixeira et al.
Pharmaceutical development and technology, 25(4), 408-415 (2019-12-19)
Introduction: Glioblastoma (GB) is the most common malignant brain tumor and is characterized by high invasiveness, poor prognosis, and limited therapeutic options. Silencing gene expression, through the use of small interfering RNA (siRNA), has been proposed as an alternative to
Wuming Gong et al.
BMC bioinformatics, 7, 516-516 (2006-11-30)
Short interfering RNAs have allowed the development of clean and easily regulated methods for disruption of gene expression. However, while these methods continue to grow in popularity, designing effective siRNA experiments can be challenging. The various existing siRNA design guidelines
Avraam El Hamidieh et al.
PloS one, 7(8), e42722-e42722 (2012-08-23)
Cdc37 is a 50 kDa molecular chaperone which targets intrinsically unstable protein kinases to the molecular chaperone HSP90. It is also an over-expressed oncoprotein that mediates carcinogenesis and maintenance of the malignant phenotype by stabilizing the compromised structures of mutant
Shun Yao et al.
Cancer letters, 502, 1-8 (2020-12-07)
Angio-associated migratory cell protein (AAMP) is considered a pro-tumor protein, which contributes to angiogenesis, proliferation, adhesion, and other biological activities. Although AAMP is known to facilitate the motility of breast cancer cells and smooth muscle cells by regulating ras homolog
Ya-Jie Zhang et al.
World journal of gastroenterology, 20(25), 8229-8236 (2014-07-11)
To investigate the effect of Girdin knockdown on the chemosensitivity of colorectal cancer cells to oxaliplatin and the possible mechanisms involved. Four siRNAs targeting Girdin were transfected into the chemoresistant colorectal cancer cell line DLD1. Real-time polymerase chain reaction (PCR)

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service