Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

Ensembl | human accession no.

ENSG00000154727

NCBI accession no.

NM_002040

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GABPA(2551) , GABPA(2551)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be
Yun Peng Shao et al.
Neurourology and urodynamics, 37(8), 2470-2479 (2018-06-20)
The present work evaluated preventive effect of curcumin on cisplatin-induced bladder cystopathy. Fifteen female rats were divided into (i) Control group administered with physiological saline solution for 5 days; (ii) Cis-P group injected with cisplatin (6 mg/kg); and (iii) Cis-Cur group
Yanxia Guo et al.
Cell death and differentiation, 27(6), 1862-1877 (2019-12-06)
TERT promoter mutations occur in the majority of glioblastoma, bladder cancer (BC), and other malignancies while the ETS family transcription factors GABPA and its partner GABPB1 activate the mutant TERT promoter and telomerase in these tumors. GABPA depletion or the
Arpita Chatterjee et al.
Redox biology, 34, 101542-101542 (2020-05-04)
Radiation is a common anticancer therapy for many cancer patients, including prostate cancer. Diabetic prostate cancer patients suffer from increased lymph node metastasis, tumor recurrence and decreased survival as compared to non-diabetic prostate cancer patients. These patients are also at
Lu Gao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(10), 3322-3338 (2018-07-22)
Diabetes contributes to cardiovascular complications and the pathogenesis of cardiac remodeling that can lead to heart failure. We aimed to evaluate the functional role of LAZ3 in diabetic cardiomyopathy (DCM). Streptozotocin (STZ) was used to induce a diabetic mouse model.
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service