Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU069011

Sigma-Aldrich

MISSION® esiRNA

targeting human CS

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CS(1431) , CS(1431)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pei-Yao Xu et al.
International journal of nanomedicine, 13, 4685-4698 (2018-08-30)
In recent times, the co-delivery therapeutics have garnered enormous interest from researchers in the treatment of cancers with multidrug resistance (MDR) due to their efficient delivery of multiple agents, which result in synergistic effects and capable of overcoming all the
Takeshi Nakajima et al.
Investigative ophthalmology & visual science, 55(8), 5278-5283 (2014-07-24)
Activation of calpains (calpain 2 and Lp82) in rodent lenses readily causes proteolysis and cataract formation. In contrast, primate lenses are quite resistant to activation of calpains. The hypothesis is that high levels of human endogenous calpain inhibitor, calpastatin (CS)
Ana Vanessa Nascimento et al.
Molecular pharmaceutics, 11(10), 3515-3527 (2014-09-27)
RNA interference has emerged as a powerful strategy in cancer therapy because it allows silencing of specific genes associated with tumor progression and resistance. Mad2 is an essential mitotic checkpoint component required for accurate chromosome segregation during mitosis, and its

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service