Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU067151

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP13

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiao-Dong Li et al.
Chinese medical journal, 130(6), 717-721 (2017-03-18)
Dendritic cells are professional antigen-presenting cells found in an immature state in epithelia and interstitial space, where they capture antigens such as pathogens or damaged tissue. Matrix metallopeptidase 13 (MMP-13), a member of the collagenase subfamily, is involved in many
Nobuaki Ozeki et al.
International journal of molecular sciences, 17(2), 221-221 (2016-02-11)
We established a differentiation method for homogeneous α7 integrin-positive human skeletal muscle stem cell (α7⁺hSMSC)-derived osteoblast-like (α7⁺hSMSC-OB) cells, and found that interleukin (IL)-1β induces matrix metalloproteinase (MMP)-13-regulated proliferation of these cells. These data suggest that MMP-13 plays a potentially unique
Rui Min Li et al.
American journal of cancer research, 8(6), 964-980 (2018-07-24)
The highly refractory nature of cervical cancer to chemotherapeutic drugs and its epithelial-to-mesenchymal transition (EMT) are the key reasons contributing to the poor prognosis of this disease. Golgi Membrane Protein 1 (GOLM1), a protein involved in the trafficking of proteins
Chia-Li M Shih et al.
Molecular biology reports, 42(7), 1225-1232 (2015-02-16)
Adipose tissue remodeling by the matrix metalloproteases (MMPs) is critical for tissue hypertrophy and obesity. MMP-13 is an important protein that is highly expressed in adipose tissue but whose potential role in adipose tissue expansion is poorly characterized. We investigated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service