Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU066241

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGAAAAAGGGCAGATCATGCGGGGAGATGACCTTGATCTTTGATTGCTACCCTAACCTTGACCTTTAACCCGTGATTCCCCCCAGCTCCTGGAAGAGATGTCCTAATATCTCTTAGGGACCCAGACCCCTAAATTCTCCTCCTCCCCCATTTTGATGTTAAGGTGGAGAGGGCATATGCATCCTCTGTCCTGATCTAGGTGTCTATAGCTGAGGGGTAAGAGGTTGTTGTAGTTGTCCTGGTGCCTCCATCAGACTCTCCCTACTTGTCCCATATTTGCAAGGGGAGGGGATTTGGGGCTGGGGCTCCATTCACCAAAGCTGAGGTGGCTTCTCATTAACCCTTTAGGACTCTGAAGGGTATGGACCTACGTGAATGTGTGTCAGGGGGAGACTTGCTGGTGGGTTAGTGGT

Ensembl | human accession no.

ENSG00000165795

NCBI accession no.

NM_201535

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NDRG2(57447) , NDRG2(57447)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Z H Su et al.
Neoplasma, 67(5), 1002-1011 (2020-05-27)
Renal cell carcinoma (RCC) is the most common malignant tumor of the kidney. In this study, we investigated the role of miR-346 in RCC cells under hypoxia. OS-RC-2 and 786-O cells were cultured in 1% O2 or normal oxygen. Cell
A Das et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 22(7), 1138-1145 (2019-11-17)
N-myc downstream-regulated gene 2 (NDRG2) is down-regulated in grade-III meningioma [anaplastic meningioma (AM)] and associated with clinically aggressive behavior. Current therapies in the treatment of high-grade meningioma are lacking with limited success. This study aims to validate the effect of
Fenhong Kang et al.
Journal of ovarian research, 13(1), 48-48 (2020-04-30)
The cancer cell metastasis and the acquisition of chemotherapy resistance remain huge challenge for ovarian cancer treatment. Previously, N-myc downstream-regulated gene 2 (NDRG2) serves as a tumor suppressor for many cancers. Here, we attempted to investigate the specific roles of
Kyeongah Kang et al.
Biochemical and biophysical research communications, 468(4), 611-616 (2015-11-08)
N-Myc downstream-regulated gene 2 (NDRG2), a member of the NDRG family of differentiation-related genes, has been characterized as a regulator of dendritic cell differentiation from monocytes, CD34(+) progenitor cells, and myelomonocytic leukemic cells. In this study, we show that NDRG2
Qiang Fu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 120-127 (2017-10-29)
MicroRNA-454 (miR-454) is emerging as critical regulator in tumorigenesis; it may function as an oncogene or a tumor suppressor. However, the role of miR-454 in prostate cancer remains unknown. In this study, we aimed to investigate the function and molecular
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service