Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU065611

Sigma-Aldrich

MISSION® esiRNA

targeting human NCOR1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTCTTTCAGCCACCATTGCTAGGAGTGAGCATGAGATTTCTGAAATTATTGATGGGCTCTCTGAGCAGGAGAATAATGAGAAACAAATGCGGCAGCTCTCTGTGATTCCACCTATGATGTTTGATGCAGAACAAAGACGAGTCAAGTTCATTAACATGAATGGGCTTATGGAGGACCCTATGAAAGTGTATAAAGATAGGCAGTTTATGAATGTTTGGACTGACCATGAAAAGGAGATCTTTAAGGACAAGTTTATCCAGCATCCAAAAAACTTTGGACTAATTGCATCATACTTGGAGAGGAAGAGTGTTCCTGATTGTGTTTTGTATTACTATTTAACCAAGAAAAATGAGAATTATAAAGCCCTCGTCAGAAGGAATTATGGGAAACGCAGAGGCAGAAACCAGCAAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jung-Yoon Yoo et al.
Oncotarget, 4(7), 972-983 (2013-05-15)
The aberrant expressions of casein kinase 2 (CK2) was found in prostate cancer patient and cell lines, but little is known of the detailed mechanisms implicated in prostate tumorigenesis. In this study, we report that both CK2 activity and CK2-mediated
Sandra M Lopez et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(15), 3937-3949 (2016-03-13)
Castration therapy in advanced prostate cancer eventually fails and leads to the development of castration-resistant prostate cancer (CRPC), which has no cure. Characteristic features of CRPC can be increased androgen receptor (AR) expression and altered transcriptional output. We investigated the
Ying Lu et al.
PloS one, 8(11), e79815-e79815 (2013-11-22)
Rosiglitazone (RGL), a synthetic agonist for peroxisome proliferator activated receptor γ (PPARγ), exhibits a potent anti-inflammatory activity by attenuating local infiltration of neutrophils and monocytes in the renal interstitium. To evaluate the mechanisms that account for inhibiting inflammatory cells infiltration
Hyeon-Ju Lee et al.
Toxins, 12(6) (2020-07-08)
Zearalenone (ZEN) is a non-steroidal mycotoxin that has various toxicological impacts on mammalian health. Here, we found that ZEN significantly affected the production of nitric oxide (NO) and the expression of endothelial NO synthase (eNOS) of bovine aortic endothelial cells
Lu Tang et al.
FEBS open bio, 10(12), 2678-2686 (2020-10-16)
Prostate cancer (PCa) is the most frequently diagnosed male cancer. An earlier study of a cohort of 333 primary prostate carcinomas showed that 74% of these tumors fell into one of seven subtypes of a molecular taxonomy defined by specific

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service