Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU061891

Sigma-Aldrich

MISSION® esiRNA

targeting human VTCN1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGACCAGGGAGCCAACTTCTCGGAAGTCTCCAATACCAGCTTTGAGCTGAACTCTGAGAATGTGACCATGAAGGTTGTGTCTGTGCTCTACAATGTTACGATCAACAACACATACTCCTGTATGATTGAAAATGACATTGCCAAAGCAACAGGGGATATCAAAGTGACAGAATCGGAGATCAAAAGGCGGAGTCACCTACAGCTGCTAAACTCAAAGGCTTCTCTGTGTGTCTCTTCTTTCTTTGCCATCAGCTGGGCACTTCTGCCTCTCAGCCCTTACCTGATGCTAAAATAATGTGCCTCGGCCACAAAAAAGCATGCAAAGTCATTGTTACAACAGGGATCTACAGAACTATTTCACCACCAGATATGACCTAGTTTTATATTTCTGGGAGGAAATGAATTCATATCTAGAAGTCTGGAGTGAGCAAACAAGAGCAAGAAACAAAAAGAAGCCAAAAGCAGAAGGCTCCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fu-Biao Kang et al.
Oncotarget, 8(46), 80878-80888 (2017-11-09)
B7-H4, another member of costimulatory molecule, has been shown to be overexpressed in multiple types of tumors, including hepatocellular carcinoma (HCC). However, the specific biological role of B7-H4 in HCC still needs to be further explored. In this study, we
Xinran Chen et al.
Cancer science, 107(7), 944-954 (2016-04-19)
B7-H4, one of the costimulatory molecules of the B7 family, has been found to be widely expressed in many kinds of tumor tissues and to play an important part in tumor progression and poor prognosis. However, the role of B7-H4
Ying Feng et al.
Pathology, research and practice, 218, 153323-153323 (2021-01-12)
B7-H4 is a unique negative regulator of T cells that is typically significantly overexpressed in various carcinomas and is associated with poor prognosis. However, the effects of B7-H4 expression on epithelial-mesenchymal transition (EMT) and cancer stemness of colorectal cancer (CRC)
Xiaochen Hu et al.
Neoplasia (New York, N.Y.), 22(11), 539-553 (2020-09-24)
Trastuzumab is a humanized mAb used to treat HER2-overexpressing breast cancer; however its mechanisms remain to be fully elucidated. Previous studies suggest a role for immunity in mediating trastuzumab-specific antitumor effects. This study evaluated the role(s) of trastuzumab and other
Haoyue Li et al.
Experimental and molecular pathology, 114, 104406-104406 (2020-02-24)
B7-H4 is a member of B7 family which regulates immune responses by delivering costimulatory signals. However, it negatively regulates T cell-mediated immunity and may play an important role in tumor immune evasion. Although several studies have been reported that expression

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service