Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU051971

Sigma-Aldrich

MISSION® esiRNA

targeting human CD69

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAATAAGGAAACATGTTCACTTATTGACTATTATAGAATGGAACTCAAGGAAATCTGTGTCAGTGGATGCTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuki Miyamoto et al.
Nature communications, 7, 13478-13478 (2016-11-24)
Oligodendrocytes differentiate to wrap their plasma membranes around axons, forming the myelin sheath. A neuronal cue is one of the regulator elements controlling this process. Here, we demonstrate that VCAM1, which plays a key role throughout the immune system, is
Lei Yu et al.
Cell death & disease, 9(9), 905-905 (2018-09-07)
Foxp3+ regulatory T cells (Tregs) can inhibit immune responses and maintain immune tolerance by secreting immunosuppressive TGF-β1 and IL-10. However, the efficiency of Tregs become the major obstacle to their use for immunotherapy. In this study, we investigated the relevance
Shih-Yun Huang et al.
Journal of cellular physiology, 233(9), 7467-7479 (2018-04-18)
Chronic myeloid leukemia (CML) is caused by a constitutively active BCR-ABL tyrosine kinase. Tyrosine kinase inhibitors (TKIs) imatinib and its derivatives represent a breakthrough for CML therapy, but the use of TKI alone is ineffective for many CML patients. CD69
Haiyan Hu et al.
Molecular medicine reports, 18(3), 3085-3092 (2018-07-18)
Cardiac fibrosis is characterized as net accumulation of ECM (extracellular matrix) proteins in the cardiac interstitium, which contributes to dysfunction of both systolic and diastolic. The present study aimed to identify the association between microRNA (miR)‑367‑3p and cluster of differentiation 69

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service