Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU051621

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCACTTCACCCTGATCCAGGCGTTTTGCTGCGAGAACGACATCAACATCCTGCGCGTCAGCAACCCGGGCCGGCTGGCGGAGCTCCTGCTCTTGGAGACCGACGCTGGCCCCGCGGCGAGCGAGGGCGCCGAGCAGCCCCCGGACCTGCACTGCGTGCTGGTGACGAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAAGTCAACTTATTTGTTTTTGCCGGGAAAGTCGCTACATGGATCAATGGGTTCCAGTGATTAATCTCCCTGAACGGTGATGGCATCTGAATGAAAATAACTGAACCAAATTGCACTGAAGTTTTTGAAATACCTTTGTAGTTACTCAAGCAGTTACTCCCTACACTGATGCAAGGATTACAGAAACTGATGCCAAGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Tan et al.
Experimental cell research, 370(2), 718-724 (2018-07-29)
Long non-coding RNA (lncRNA) are key regulatory molecules that are implicated in diverse biological processes and human diseases, including preeclampsia. However, their expression and functions in the progression of preeclampsia remains largely unclear. In this study, lncRNA DLX6-AS1 was confirmed
Pei Ma et al.
Molecular therapy. Nucleic acids, 22, 382-395 (2020-11-25)
Long noncoding RNAs (lncRNAs), genomic "dark matter," are deeply involved in diverse biological processes. The lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) is a highly participatory lncRNA; however, its roles in gastric cancer (GC) remain largely unexplored. Here, we demonstrated
Rui-Xue Sun et al.
Gene, 763, 145030-145030 (2020-08-07)
To investigate the impact and the mechanism of Gadd45α mediating p38MAPK pathway on the retinal ganglion cells (RGCs) injury in chronic ocular hypertension (COH) rats. COH model in rats were established and intraocular pressure (IOP) was tested. Retrograde labeling was
B Wang et al.
Journal of molecular cell biology, 9(4), 338-349 (2017-10-11)
Retinoic acid (RA), a bioactive metabolite of vitamin A, is a critical mediator of cell differentiation. RA blocks adipogenesis, but mechanisms remain to be established. ZFP423 is a key transcription factor maintaining white adipose identity. We found that RA inhibits

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service