Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU050581

Sigma-Aldrich

MISSION® esiRNA

targeting human NEK7

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGGTGGTAAAACTTGGAGATCTTGGGCTTGGCCGGTTTTTCAGCTCAAAAACCACAGCTGCACATTCTTTAGTTGGTACGCCTTATTACATGTCTCCAGAGAGAATACATGAAAATGGATACAACTTCAAATCTGACATCTGGTCTCTTGGCTGTCTACTATATGAGATGGCTGCATTACAAAGTCCTTTCTATGGTGACAAAATGAATTTATACTCACTGTGTAAGAAGATAGAACAGTGTGACTACCCACCTCTTCCTTCAGATCACTATTCAGAAGAACTCCGACAGTTAGTTAATATGTGCATCAACCCAGATCCAGAGAAGCGACCAGACGTCACCTATGTTTATGACGTAGCAAAGAGGATGCATGCATGCACTGCAAGCAGCTAAACATGCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gen Li et al.
Frontiers in neurology, 11, 551-551 (2020-08-01)
Background: Subarachnoid hemorrhage (SAH) is a devastating disease which leads to high morbidity and mortality. Recent studies have indicated that, never in mitosis gene A-related expressed kinase 7 (NEK7), is involved in NLRP3 (NLR family, pyrin domain containing 3) associated
Huan Liu et al.
Biochemical pharmacology, 177, 113998-113998 (2020-05-01)
Disordered immune regulation and persistent inflammatory damage are the key mechanisms of ventilator-induced lung injury (VILI). NLR family pyrin domain containing 3 (NLRP3) inflammasome activation causes VILI by mediating the formation of inflammatory mediators and infiltration of inflammatory cells, increasing
Yuan Yue et al.
Cell death & disease, 9(9), 904-904 (2018-09-07)
The molecular mechanisms underlying the severe lung pathology that occurs during SARS-CoV infections remain incompletely understood. The largest of the SARS-CoV accessory protein open reading frames (SARS 3a) oligomerizes, dynamically inserting into late endosomal, lysosomal, and trans-Golgi-network membranes. While previously
Ana Tapia-Abellán et al.
Nature chemical biology, 15(6), 560-564 (2019-05-16)
NLRP3 (NOD-like receptor pyrin domain-containing protein 3) is an innate immune sensor that contributes to the development of different diseases, including monogenic autoinflammatory syndromes, gout, atherosclerosis, and Alzheimer's disease. The molecule sulfonylurea MCC950 is a NLRP3 inflammasome inhibitor with potential

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service