Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU049781

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX5

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGTCGAGGAGTGTGACAATGAGAAAGAGTCAAAGGTCGTCCAAGGGCTCTGAGATACTTTTGGAGAAACACAAATTCTGTAACATCAAGTGCTACATCGATGGGCCTTATGGGACCCCCACCCGCAGGATCTTTGCCTCTGAGCATGCCGTGCTCATCGGGGCAGGCATCGGCATCACCCCCTTTGCTTCCATTCTGCAGAGTATCATGTACAGGCACCAGAAAAGAAAGCATACTTGCCCCAGCTGCCAGCACTCCTGGATCGAAGGTGTCCAAGACAACATGAAGCTCCATAAGGTGGACTTTATCTGGATCAACAGAGACCAGCGGTCTTTCGAGTGGTTTGTGAGCCTGCTGACTAAACTGGAGATGGACCAGGCCGAGGAGGCTCAATACGGCCGCTTCCTGGAGCTGCATATGTACATGACATCTGCACTGGGCAAGAATGACATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Farhan Rizvi et al.
PloS one, 7(4), e34440-e34440 (2012-04-19)
To determine whether NOX 5 is expressed in rabbit corneal stromal cells (RCSC). NADPH oxidases (NOXes) are enzymes that preferentially use NADPH as a substrate and generate superoxide. Several isoforms of NOXes function as multi-protein complexes while NOX5 and DUOXs
Dan Li et al.
The Journal of pharmacology and experimental therapeutics, 360(1), 14-22 (2016-10-21)
We have shown that NADPH oxidase (NOX)5-S may mediate the acid-induced decrease in cell apoptosis. However, mechanisms of NOX5-S-dependent decrease in cell apoptosis are not fully understood. In this study, we found that silencer-of-death domain (SODD) was significantly increased in
Hope K A Gole et al.
PloS one, 9(8), e105337-e105337 (2014-08-22)
NADPH oxidase (NOX) is the primary source of reactive oxygen species (ROS) in vascular smooth muscle cells (SMC) and is proposed to play a key role in redox signaling involved in the pathogenesis of cardiovascular disease. Growth factors and cytokines
Jie Chen et al.
Signal transduction and targeted therapy, 5(1), 139-139 (2020-08-15)
Reactive oxygen species (ROS) localized at the precise subcellular compartments are essential for regulating the activity of signaling proteins. Furthermore, ROS are master regulators of tumor malignant progression that respond to a diverse set of environmental stress, especially hypoxia. NADPH
S Carnesecchi et al.
Free radical biology & medicine, 84, 22-29 (2015-03-24)
Reactive oxygen species (ROS) are key modulators of apoptosis and carcinogenesis. One of the important sources of ROS is NADPH oxidases (NOXs). The isoform NOX5 is highly expressed in lymphoid tissues, but it has not been detected in any common

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service