Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU047401

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAM

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGCAGATTTAAAGAACAGCTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTAAAAAGGAAAGCTATGACAAAAAAAAAAGAGTTAACACTGCTTGGAAAACCAAAAAGACCTCGTTCAGCTTATAACGTTTATGTAGCTGAAAGATTCCAAGAAGCTAAGGGTGATTCACCGCAGGAAAAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCTGACTCTGAAAAGGAATTATATATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAGTCTTGGGAAGAACAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAA

Ensembl | human accession no.

ENSG00000108064

NCBI accession no.

NM_003201

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TFAM(7019) , TFAM(7019)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hiroya Yamada et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 11431-11442 (2019-07-18)
Fructose consumption is rising globally, but maternal high fructose intake might adversely affect offspring. Our previous report demonstrated that excess maternal fructose intake impairs hippocampal function in offspring, indicating that the hippocampi of offspring are highly sensitive to maternal fructose.
Hao Ni et al.
Cancer biology & medicine, 18(1), 139-154 (2021-02-26)
Vascular endothelial growth factor (VEGF), apart from its predominant roles in angiogenesis, can enhance cancer cell proliferation, but its mechanisms remain elusive. The purpose of the present study was therefore to identify how VEGF regulates cancer cell proliferation. VEGF effects
Meng Zhao et al.
Theranostics, 11(4), 1845-1863 (2021-01-08)
Aims: Ischemia-reperfusion injury (IRI)-induced acute kidney injury (IRI-AKI) is characterized by elevated levels of reactive oxygen species (ROS), mitochondrial dysfunction, and inflammation, but the potential link among these features remains unclear. In this study, we aimed to investigate the specific
Xu Jiang et al.
Cancers, 12(2) (2020-02-26)
Mitochondrial transcription factor A (TFAM) is required for mitochondrial DNA replication and transcription, which are essential for mitochondrial biogenesis. Previous studies reported that depleting mitochondrial functions by genetic deletion of TFAM impaired autophagic activities. However, the underlying mechanisms remain largely
A Phillip West et al.
Nature, 520(7548), 553-557 (2015-02-03)
Mitochondrial DNA (mtDNA) is normally present at thousands of copies per cell and is packaged into several hundred higher-order structures termed nucleoids. The abundant mtDNA-binding protein TFAM (transcription factor A, mitochondrial) regulates nucleoid architecture, abundance and segregation. Complete mtDNA depletion

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service