Biologically-prepared, esiRNA are comprised of a heterogeneous pool of siRNA that all target the same mRNA sequence. The targeted mRNA sequence used to generate the pool of siRNA is noted under the PROPERTIES section of the Product Detail Page as the esiRNA cDNA target sequence.
Select a Size
20 μG
$220.00
50 μG
$391.00
$220.00
Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me
Get notified when this item is ready to ship via email.
All Photos(1)
Select a Size
Change View
20 μG
$220.00
50 μG
$391.00
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
$220.00
Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me
Get notified when this item is ready to ship via email.
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCAAGACATGCAGTCACAAGAAATTAGTGGCCTTAAAGACTGTGAAATAGATGCGGAAGAAAAGTATATTTCAGGGCCTCATGAGTTGTCAACAAGTCAAAACGACAATGCACACCTTCAGTGCTCTCTGCAAACAACAATGAACAAGCTGAATGAGCTAGAGAAAATATGTGAAATACTGCAGGCTGAAAAGTATGAACTCGTAACTGAGCTGAATGATTCAAGGTCAGAATGTATCACAGCAACTAGGAAAATGGCAGAAGAGGTAGGGAAACTACTAAATGAAGTTAAAATATTAAATGATGACAGTGGTCTTCTCCATGGTGAGTTAGTGGAAGACATACCAGGAGGTGAATTTGGTGAACAACCAAATGAACAGCACCCTGTGTCTTTGGCTCCATT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CENPF(1063) , CENPF(1063)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Lot/Batch Number
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Er-Bao Chen et al.
Aging, 11(18), 7473-7491 (2019-09-19)
Gastric cancer (GC) is a common disease globally with high mortality rate. It is therefore necessary to develop novel therapies targeting specific events in the pathogenesis of GC. Some hnRNP family members are involved in multiple cancer biological behaviors. However
-
Dove posso trovare la sequenza target del siRNA? Grazie - PL
1 answer-
Helpful?
-
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
