Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU045261

Sigma-Aldrich

MISSION® esiRNA

targeting human SPRY2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jun-Ho Ahn et al.
Biomolecules & therapeutics, 23(4), 320-326 (2015-07-15)
The clinical benefits of oncogenic BRAF inhibitor therapies are limited by the emergence of drug resistance. In this study, we investigated the role of a negative regulator of the MAPK pathway, Spry2, in acquired resistance using BRAF inhibitor-resistant derivatives of
Yan Liu et al.
Molecular medicine reports, 23(5) (2021-03-25)
Age-related cataract (ARC) is the primary cause of blindness worldwide. Abnormal expression of microRNAs (miRNAs/miRs) has been reported to be associated with multiple diseases, including ARC. However, the potential role of miR-124 in ARC remains unclear. The present study used
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.
Tatiana Lopatina et al.
Oncogenesis, 9(10), 90-90 (2020-10-12)
The lack of approved targeted therapies highlights the need for new treatments for triple-negative breast cancer (TNBC) patients. Interleukin-3 (IL-3) acts as an autocrine factor for tumor-endothelial cells (TEC), and exerts pro-angiogenic paracrine action via extracellular vesicles (EVs). IL-3Rα blockade

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service