Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU038231

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP6

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me

Get notified when this item is ready to ship via email.

All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

Ensembl | human accession no.

ENSG00000123610

NCBI accession no.

NM_007115

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TNFAIP6(7130) , TNFAIP6(7130)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shengchao Zhang et al.
Stem cell research & therapy, 12(1), 50-50 (2021-01-11)
Muscle stem cells (MuSCs) are absolutely required for the formation, repair, and regeneration of skeletal muscle tissue. Increasing evidence demonstrated that tissue stem cells, especially mesenchymal stem cells (MSCs), can exert therapeutic effects on various degenerative and inflammatory disorders based
Ju-Hyun An et al.
PloS one, 15(2), e0220756-e0220756 (2020-02-11)
Adipose tissue derived mesenchymal stem/stromal cell (ASC)-derived extracellular vesicles (EV) have been reported to be beneficial against dextran sulfate sodium (DSS)-induced colitis in mice. However, the underlying mechanisms have not been fully elucidated. We hypothesize that the tumor necrosis factor-α-stimulated
Yuhki Koike et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(5), 6824-6836 (2020-03-31)
Ischemia/reperfusion (I/R) is implicated in the pathogenesis of various acute intestinal injuries. Amniotic fluid stem cells (AFSC) are beneficial in experimental intestinal diseases. Tumor necrosis factor-induced protein 6 (TSG-6) has been shown to exert anti-inflammatory effects. We aimed to investigate
Xifeng Li et al.
Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association, 29(12), 104986-104986 (2020-09-30)
Early brain injury (EBI) refers to acute brain injury during the first 72 h after subarachnoid hemorrhage (SAH), which is one of the major causes of poor prognosis after SAH. Here, we investigated the effect and the related mechanism of
Xiangwen Zhang et al.
Tissue & cell, 68, 101455-101455 (2020-11-23)
TNFα-stimulated gene-6 (TNFAIP6) plays an important role in the prognosis of many tumors. Our objective was to investigate the clinical and prognostic value of TNFAIP6 expression in gastric cancer (GC) patients. Here, we investigated the expression of TNFAIP6 in GC
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service