Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU034721

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTCAATCATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Carmelo Millón et al.
The international journal of neuropsychopharmacology, 18(3) (2014-12-19)
Galanin (GAL) plays a role in mood regulation. In this study we analyzed the action of the active N-terminal fragment [GAL(1-15)] in anxiety- and depression-related behavioral tests in rats. The effect of GAL(1-15) was analyzed in the forced swimming test
Noor Al-Obaidi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 373-387 (2018-07-06)
Chronic exposure of tubular renal cells to high glucose contributes to tubulointerstitial changes in diabetic nephropathy. In the present study, we identified a new fibrosis gene called galectin-1 (Gal-1), which is highly expressed in tubular cells of kidneys of type
Bing Yan et al.
International journal of biological sciences, 12(7), 850-860 (2016-06-18)
Lung cancer is the leading cause of cancer mortality around the world. Despite advances in the targeted therapy, patients with lung squamous cell carcinoma(SCC) still benefit few from it, and the search for potential effective therapies is imperative. Here, we
Jie Zhu et al.
American journal of translational research, 11(6), 3862-3878 (2019-07-18)
It has been reported that Galectin-1 (Gal-1) indicates bad prognosis of patients with ovarian cancer, and Gal-1 overexpression promotes metastasis of ovarian cancer cells. Nevertheless, the underlying mechanisms of the Gal-1-mediated enhancement of metastasis are still unclear. Furthermore, little is
Neus Martínez-Bosch et al.
Cancer research, 74(13), 3512-3524 (2014-05-09)
Despite some advances, pancreatic ductal adenocarcinoma (PDAC) remains generally refractory to current treatments. Desmoplastic stroma, a consistent hallmark of PDAC, has emerged as a major source of therapeutic resistance and thus potentially promising targets for improved treatment. The glycan-binding protein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service