Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU034291

Sigma-Aldrich

MISSION® esiRNA

targeting human FOS

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)
All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT

Ensembl | human accession no.

ENSG00000170345

NCBI accession no.

NM_005252

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FOS(2353) , FOS(2353)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
MSS
DIS
ZOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

H Pan et al.
Current molecular medicine, 16(3), 266-275 (2016-02-27)
Endometriosis is a frequent gynecological disease associated with severe pain and infertility. Although its dependency on estrogen is well recognized, the molecular mechanism along the estrogenic pathway has not been fully understood. This study investigates the effect of 17β-estradiol (E2)
Ningbo Zheng et al.
International journal of medical microbiology : IJMM, 309(8), 151340-151340 (2019-09-09)
Chlamydia pneumoniae (C. pneumoniae) infection is associated with the initiation and progression of atherosclerosis. The migration of vascular smooth muscle cell (VSMC) from the media to the intima is a key event in the development of atherosclerosis. Interleukin-17C (IL-17C) could
Li Lin et al.
Journal of cellular physiology, 234(10), 18928-18941 (2019-04-21)
Pre-eclampsia (PE) is a serious hypertensive disorder of pregnancy that remains a leading cause of perinatal and maternal morbidity and mortality worldwide. Placental ischemia/hypoxia and the secretion of soluble fms-like tyrosine kinase 1 (sFlt1) into maternal circulation are involved in
Rui Bao et al.
American journal of translational research, 8(5), 2284-2292 (2016-06-28)
Forkhead/winged helix transcription factor p3 (Foxp3) increases in CD4(+)CD25(+)Treg cells during sepsis; however, related mechanisms are unclear. Our study aimed to explore the possible molecular mechanisms of high expression of Foxp3 in Treg cells during sepsis. Sepsis was induced by
Huynh T Hop et al.
Frontiers in cellular and infection microbiology, 8, 287-287 (2018-09-07)
The cellular oncogene c-Fos (c-Fos) is a component of activator protein 1 (AP1), a master transcriptional regulator of cells. The suppression of c-Fos signaling by siRNA treatment resulted in significant induction of TLR4, which subsequently activates p38 and ERK1/2 mitogen-activated
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service