Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU030621

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCC4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCTCTGGAGAGCCAAGATACAGAGAATGTCCCAGTTACACTATCAGAGGAGAACCGTTCTGAAGGAAAAGTTGGTTTTCAGGCCTATAAGAATTACTTCAGAGCTGGTGCTCACTGGATTGTCTTCATTTTCCTTATTCTCCTAAACACTGCAGCTCAGGTTGCCTATGTGCTTCAAGATTGGTGGCTTTCATACTGGGCAAACAAACAAAGTATGCTAAATGTCACTGTAAATGGAGGAGGAAATGTAACCGAGAAGCTAGATCTTAACTGGTACTTAGGAATTTATTCAGGTTTAACTGTAGCTACCGTTCTTTTTGGCATAGCAAGATCTCTATTGGTATTCTACGTCCTTGTTAACTCTTCACAAACTTTGCACAACAAAATGTTTGAGTCAATTCTGAAAGCTCCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xue Zhu et al.
Acta biochimica et biophysica Sinica, 50(9), 914-920 (2018-07-31)
Carboplatin is the most commonly used drug in the first-line treatment of human retinoblastoma (RB), but its clinical application is greatly limited due to acquired drug resistance upon the long-term treatment. Forkhead box protein M1 (FoxM1) is the transcription factor
Alejandro Carozzo et al.
Molecular pharmacology, 96(1), 13-25 (2019-05-03)
Pancreatic cancer is one of the most lethal types of tumors with no effective therapy available; is currently the third leading cause of cancer in developed countries; and is predicted to become the second deadliest cancer in the United States
Nobuaki Tanaka et al.
Prostaglandins, leukotrienes, and essential fatty acids, 159, 102139-102139 (2020-06-17)
ATP-binding cassette transporter C4 (ABCC4) is associated with multidrug resistance and the regulation of cell signalling. Some prostaglandins (PGs), including: PGE2, PGF2α, PGE3, and PGF3α are known substrates of ABCC4, and are released from some types of cells to exert

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service