Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU026401

Sigma-Aldrich

MISSION® esiRNA

targeting human STIM1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCAGTCCGTAACATCCACAAACTGATGGACGATGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTGAGGGAAGACCTCAATTACCATGACCCAACAGTGAAACACAGCACCTTCCATGGTGAGGATAAGCTCATCAGCGTGGAGGACCTGTGGAAGGCATGGAAGTCATCAGAAGTATACAATTGGACCGTGGATGAGGTGGTACAGTGGCTGATCACATATGTGGAGCTGCCTCAGTATGAGGAGACCTTCCGGAAGCTGCAGCTCAGTGGCCATGCCATGCCAAGGCTGGCTGTCACCAACACCACCATGACAGGGACTGTGCTGAAGATGACAGACCGGAGTCATCGGCAGAAGCTGCAGCTGAAGGCTCTGGATACAGTGCTCTTTGGGCCTCCTCTCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dongyu Wei et al.
Frontiers in cellular neuroscience, 11, 400-400 (2018-01-10)
Store-operated calcium channels (SOCs) are highly calcium-selective channels that mediate calcium entry in various cell types. We have previously reported that intraplantar injection of YM-58483 (a SOC inhibitor) attenuates chronic pain. A previous study has reported that the function of
Yadong Wang et al.
Oncotarget, 7(52), 86584-86593 (2016-11-20)
This study aimed to address the potential role of STIM1 (stromal interaction molecule 1) in lung tumorigenesis. Colony formation in soft agar assay and tumorigenicity in nude mice assay were conducted. Western blot, immunohistochemistry and quantitative real-time polymerase chain reaction
Yan-Yang Mao et al.
Biochemical and biophysical research communications, 505(1), 119-125 (2018-09-23)
The prevention and treatment of coronary heart disease (CHD) is a difficult problem to be solved. More and more studies have found that circular RNAs (circRNAs) may play important roles in the development of CHD. Here detection of vascular smooth
Ping Li et al.
Cell calcium, 71, 45-52 (2018-04-02)
Bone resorption is mainly mediated by osteoclasts (OCs), whose formation and function are regulated by intracellular Ca2+ oscillation. Our previous studies demonstrated that fluid shear stress (FSS) lead to Ca2+ oscillation through mechanosensitive cation-selective channels. However, the specific channels responsible
Ping Li et al.
PloS one, 12(5), e0177484-e0177484 (2017-05-12)
Calcium signal plays an important role in a variety of cancer cell metabolism, but knowledge on its role in head and neck squamous cell carcinoma (HNSCC) is limited. Store-operated calcium entry (SOCE) is the principal Ca2+ entry mechanism that maintains

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service