Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU025841

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

Notify Me

Get notified when this item is ready to ship via email.


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

Notify Me

Get notified when this item is ready to ship via email.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Soniya Bastola et al.
Nature communications, 11(1), 4660-4660 (2020-09-18)
Intratumor spatial heterogeneity facilitates therapeutic resistance in glioblastoma (GBM). Nonetheless, understanding of GBM heterogeneity is largely limited to the surgically resectable tumor core lesion while the seeds for recurrence reside in the unresectable tumor edge. In this study, stratification of
Xiaohua Yan et al.
Journal of molecular cell biology, 10(1), 48-59 (2017-10-17)
Evading TGF-β-mediated growth inhibition is often associated with tumorigenesis in liver, including hepatocellular carcinoma (HCC). To better understand the functions and the underlying molecular mechanisms of TGF-β in HCC initiation and progression, we carried out transcriptome sequencing (RNA-Seq) to identify
Naohiro Egawa et al.
Glia, 67(4), 718-728 (2019-02-23)
During development or after brain injury, oligodendrocyte precursor cells (OPCs) differentiate into oligodendrocytes to supplement the number of oligodendrocytes. Although mechanisms of OPC differentiation have been extensively examined, the role of epigenetic regulators, such as histone deacetylases (HDACs) and DNA
Chih-Cheng Chang et al.
Scientific reports, 9(1), 4606-4606 (2019-03-16)
The therapeutic effects of simvastatin for renal cell carcinoma (RCC) are controversial. In this study, the effects of simvastatin on the carcinogenic properties of 3-methylcholanthrene (3MC; an aryl-hydrocarbon receptor [AhR] agonist) in human renal epithelial cells (hRECs) were investigated. We
Libin Zhang et al.
Biological chemistry, 399(6), 603-610 (2018-03-15)
Non-small cell lung cancer (NSCLC) is a common malignant tumor. Although the abnormal expression and potential clinical prognostic value of histone deacetylase 1 (HDAC1) were recently discovered in many kinds of cancer, the roles and molecular mechanisms of HDAC1 in

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service