Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU002141

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP2K1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGAGGCCTTTCTTACCCAGAAGCAGAAGGTGGGAGAACTGAAGGATGACGACTTTGAGAAGATCAGTGAGCTGGGGGCTGGCAATGGCGGTGTGGTGTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCATGGCCAGAAAGCTAATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGCTGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGGTGCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCACATGGATGGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGAACAAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCTGAGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weiran Liu et al.
Oncotarget, 8(1), 179-190 (2016-06-23)
As shortened telomeres inhibit tumor formation and prolong life span in a KrasG12D mouse lung cancer model, we investigated the implications of telomerase in Kras-mutant NSCLC. We found that Kras mutations increased TERT (telomerase reverse transcriptase) mRNA expression and telomerase
Ching-Ting Wei et al.
Anticancer research, 39(2), 695-701 (2019-02-04)
Sorafenib is now standard treatment for advanced hepatocellular carcinoma (HCC). However, therapeutic efficacy is not as good as was predicted. Many efforts are being made to improve HCC sensitivity to sorafenib. Our previous study demonstrated that co-treatment with chrysin enhanced
Yiqun Huang et al.
Oncology reports, 41(1), 377-386 (2018-10-27)
MAPK kinase 1 (MEK1) is an upstream protein kinase of extracellular signal regulated kinase (ERK), which activates the ERK/MAPK (mitogen activated protein kinase) pathway. Importantly, bioinformatic analysis has shown that there is a target complementary binding site between miR‑101 and MEK1.
Zhongsheng Liu et al.
Cell biochemistry and function, 38(1), 87-96 (2019-11-02)
Uncarboxylated osteocalcin (unOc) is an osteoblast-derived hormone with multiple regulatory functions. Osteocalcin knockdown delays the maturation of mineral species and downregulates the expression of osteogenic-specific genes in human mesenchymal stromal cells. However, the underlying mechanisms remain unclear. Here, we investigated
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service