Skip to Content
Merck
All Photos(1)

Key Documents

EHU124431

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXM1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCCAGCAGTCTCTTACCTTCCCTGATCTTTGCAGGGTGGTCCGTGTAAATAGTATAAATTCTCCAAATTATCCTCTAATTATAAATGTAAGCTTATTTCCTTAGATCATTATCCAGAGACTGCCAGAAGGTGGGTAGGATGACCTGGGGTTTCAATTGACTTCTGTTCCTTGCTTTTAGTTTTGATAGAAGGGAAGACCTGCAGTGCACGGTTTCTTCCAGGCTGAGGTACCTGGATCTTGGGTTCTTCACTGCAGGGACCCAGACAAGTGGATCTGCTTGCCAGAGTCCTTTTTGCCCCTCCCTGCCACCTCCCCGTGTTTCCAAGTCAGCTTTCCTGCAAGAAGAAATCCTGGTTAAAAAAGTCTTTTGTATTGGGTCAGGAGTTGAATTTGGGGTGGGAGGATGGATGCAACTGAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Paweena Dana et al.
Cellular oncology (Dordrecht), 43(2), 211-222 (2019-11-16)
Cholangiocarcinoma (CCA) is an aggressive type of cancer. The major obstacles for treatment are its late presentation and the occurrence metastases. Targeting the metastatic process may serve as a treatment option. CD147 is a membrane protein that promotes CCA metastasis.
Xiaocheng Cao et al.
Journal of oncology, 2020, 8978930-8978930 (2020-04-21)
Whether DNA methyltransferase 1 (DNMT1)/miR-34a/FoxM1 signaling promotes the stemness of liver cancer stem cells (LCSCs) remains unclear. This study aimed to assess whether methylation-based silencing of miR-34a by DNMT1 contributes to stemness features via FoxM1 upregulation in LCSCs. The CD133+
Ying Z Mazzu et al.
Molecular oncology, 13(9), 1944-1958 (2019-06-22)
Epigenetic silencing of miRNA is a primary mechanism of aberrant miRNA expression in cancer, and hypermethylation of miRNA promoters has been reported to contribute to prostate cancer initiation and progression. Recent data have shown that the miR-193b promoter is hypermethylated
Qiyan Hu et al.
Oncology letters, 15(6), 10063-10069 (2018-06-22)
Cervical cancer is the second most common type of cancer in females worldwide. It has been demonstrated that microRNAs (miRs) serve important roles in the occurrence and development of various types of cancer, including cervical cancer. The results of the
Nien-Tsu Hsieh et al.
Journal of cellular physiology, 234(7), 11265-11275 (2018-12-01)
Non-small-cell lung cancer (NSCLC) accounts for the majority of the lung cancer cases that have become a leading cause of cancer deaths worldwide. Overexpression of transcription factor forkhead box M1 (FOXM1) is involved in the inauspicious development of several types

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service