HLTUD1491
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-4484
Synonym(s):
Tough Decoy, TuD
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
product line
MISSION®
form
liquid
concentration
≥1x106 VP/ml (via p24 assay)
technique(s)
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
mature sequence
AAAAGGCGGGAGAAGCCCCA
Sanger mature/minor accession no.
Sanger microRNA accession no.
shipped in
dry ice
storage temp.
−70°C
General description
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other Notes
Based on miRBase V19 Mature ID
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
12 - Non Combustible Liquids
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service