Skip to Content
Merck
All Photos(1)

Key Documents

EHU154471

Sigma-Aldrich

MISSION® esiRNA

targeting human NTHL1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
R 4 022,90
50 μG
R 7 158,90

R 4 022,90

List PriceR 4 105,00

Please contact Customer Service for Availability


Select a Size

Change View
20 μG
R 4 022,90
50 μG
R 7 158,90

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

R 4 022,90

List PriceR 4 105,00

Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACCAAAGACCAGGTGACGGCGGGCGCCATGCAGCGACTGCGGGCGCGGGGCCTGACGGTGGACAGCATCCTGCAGACAGATGATGCCACGCTGGGCAAGCTCATCTACCCCGTCGGTTTCTGGAGGAGCAAGGTGAAATACATCAAGCAGACCAGCGCCATCCTGCAGCAGCACTACGGTGGGGACATCCCAGCCTCTGTGGCCGAGCTGGTGGCGCTGCCGGGTGTTGGGCCCAAGATGGCACACCTGGCTATGGCTGTGGCCTGGGGCACTGTGTCAGGCATTGCAGTGGACACGCATGTGCACAGAATCGCCAACAGGCTGAGGTGGACCAAGAAGGCAACCAAGTCCCCAGAGGAGACCCGCGCCGCCCTGGAGGAGTGGCTGCCTAGGGAGCTGTGGCACGAGATCAATGGACTCTTGGTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tyler Golato et al.
Scientific reports, 7(1), 13007-13007 (2017-10-13)
Base excision repair (BER) is the predominant pathway for coping with most forms of hydrolytic, oxidative or alkylative DNA damage. Measuring BER capacity in living cells is valuable for both basic science applications and epidemiological studies, since deficiencies in this
R L Maher et al.
DNA repair, 57, 91-97 (2017-07-15)
Reactive oxygen species generate some 20,000 base lesions per human cell per day. The vast majority of these potentially mutagenic or cytotoxic lesions are subject to base excision repair (BER). Although chromatin remodelers have been shown to enhance the excision

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service