Skip to Content
Merck
All Photos(1)

Documents

EHU086561

Sigma-Aldrich

MISSION® esiRNA

targeting human MBNL1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAGAATTTTCATCACTAAACAATCATGCTAAAGAGGAAAGGACAGTGTGCTTGGTTAGAGTAAAGGACGAGGTCATTAGCCATATTGTATATATCGTCAAGCAACACACACAAAAGTTCCTCAGCCACAAGACATCCACATATTGCATGTTAACCAGAAGAAAAGACAACATTTTCCGGAAATCCACTGCACACTGTTGCCTATACACTTTGTACATTTAATTGATATTTGTGCTGAGGTGATATTCCTGTCTAAAAGAACAACATTGTCTTTCTTTTCTAGCACAGAGTTATGCATTCAAAGATGCATACCTAGTTAGTTTCCTATATATTCATGCCATCTTGAAAAGACAGACTATGG

Ensembl | human accession no.

ENSG00000152601

NCBI accession no.

NM_207297

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MBNL1(4154) , MBNL1(4154)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Svetlana S Itskovich et al.
Nature communications, 11(1), 2369-2369 (2020-05-14)
Despite growing awareness of the biologic features underlying MLL-rearranged leukemia, targeted therapies for this leukemia have remained elusive and clinical outcomes remain dismal. MBNL1, a protein involved in alternative splicing, is consistently overexpressed in MLL-rearranged leukemias. We found that MBNL1
Łukasz J Sznajder et al.
Nature communications, 11(1), 2022-2022 (2020-04-26)
The thymus is a primary lymphoid organ that plays an essential role in T lymphocyte maturation and selection during development of one arm of the mammalian adaptive immune response. Although transcriptional mechanisms have been well documented in thymocyte development, co-/post-transcriptional
Sandra Fischer et al.
RNA (New York, N.Y.), 26(5), 648-663 (2020-03-05)
Hypoxia is a hallmark of solid cancers, supporting proliferation, angiogenesis, and escape from apoptosis. There is still limited understanding of how cancer cells adapt to hypoxic conditions and survive. We analyzed transcriptome changes of human lung and breast cancer cells
Hongfei Liu et al.
Nucleic acids research, 46(12), 6069-6086 (2018-05-18)
We report the detailed transcriptomic profiles of human innate myeloid cells using RNA sequencing. Monocytes migrate from blood into infected or wounded tissue to differentiate into macrophages, and control inflammation via phagocytosis or cytokine secretion. We differentiated culture primary monocytes
Tanner Stokes et al.
Cell reports, 32(5), 107980-107980 (2020-08-07)
Loading of skeletal muscle changes the tissue phenotype reflecting altered metabolic and functional demands. In humans, heterogeneous adaptation to loading complicates the identification of the underpinning molecular regulators. A within-person differential loading and analysis strategy reduces heterogeneity for changes in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service