Skip to Content
Merck
All Photos(1)

Documents

EHU051021

Sigma-Aldrich

MISSION® esiRNA

targeting human UCP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCCACGGAATCAAACCTCGCTACACGGGGACTTATAATGCGTACAGAATAATAGCAACAACCGAAGGCTTGACGGGTCTTTGGAAAGGGACTACTCCCAATCTGATGAGAAGTGTCATCATCAATTGTACAGAGCTAGTAACATATGATCTAATGAAGGAGGCCTTTGTGAAAAACAACATATTAGCAGATGACGTCCCCTGCCACTTGGTGTCGGCTCTTATCGCTGGATTTTGCGCAACAGCTATGTCCTCCCCGGTGGATGTAGTAAAAACCAGATTTATTAATTCTCCACCAGGACAGTACAAAAGTGTGCCCAACTGTGCAATGAAAGTGTTCACTAACGAAGGACCAACGGCTTTCTTCAAGGGGTTGGTACCTTCCTTCTTGCGACTTGGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiyong Xiong et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 6(10), 1801862-1801862 (2019-05-28)
Emerging evidence has highlighted the important role of abnormal lipid accumulation in cancer development and progression, but the mechanism for this phenomenon remains unclear. Here, it is demonstrated that phospholipase C-like 1/uncoupling protein 1 (PLCL1)/(UCP1)-mediated lipid browning promotes tumor cell
Jung Hwa Lim et al.
PloS one, 11(9), e0163710-e0163710 (2016-09-30)
Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended
Jae Hoon Jeong et al.
Scientific reports, 8(1), 6672-6672 (2018-04-29)
Release of fatty acids from lipid droplets upon activation of the sympathetic nervous system (SNS) is a key step in nonshivering thermogenesis in brown adipose tissue (BAT). However, intracellular lipolysis appears not to be critical for cold-induced thermogenesis. As activation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service