Skip to Content
Merck
All Photos(1)

Key Documents

EMU049451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cltc

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAGAGCTGGTGTTTCTGTATGACAAGTACGAAGAGTATGACAATGCCATCATTACCATGATGAATCACCCCACCGATGCATGGAAGGAAGGGCAGTTCAAAGACATCATCACCAAGGTGGCTAATGTGGAACTGTACTACAAAGCAATCCAGTTCTACTTAGAATTCAAGCCTTTGTTGTTAAATGACTTGCTCATGGTGCTGTCTCCACGGTTGGATCACACTCGTGCAGTCAATTATTTCAGCAAGGTAAAACAGCTACCACTGGTGAAACCATATTTACGCTCAGTGCAGAACCACAACAACAAATCTGTGAATGAATCACTGAACAACCTCTTTATTACTGAAGAAGATTACCAGGCTCTGCGAACATCAATAGATGCTTATGACAACTTTGACAACATCTCACTTGCTCAGCGTTTG

Ensembl | mouse accession no.

ENSMUSG00000047126

NCBI accession no.

NM_001003908

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CLTC(67300) , Cltc(67300)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Odette Allonby et al.
Cellular signalling, 26(12), 2645-2657 (2014-08-26)
Ligand-induced internalisation and subsequent downregulation of receptor tyrosine kinases (RTKs) serve to determine biological outputs of their signalling. Intrinsically kinase-deficient RTKs control a variety of biological responses, however, the mechanism of their downregulation is not well understood and its analysis
Xiaofei Yan et al.
Molecular and cellular biochemistry, 398(1-2), 95-104 (2014-09-14)
Excessive reactive oxygen species (ROS) generation has been implicated as one of main agents in ouabain-induced anticancer effect. Unfortunately, the signaling pathways under it are not very clarified. In the present study, we investigated the molecular mechanism involved in ouabain-induced
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Cyril Basquin et al.
The EMBO journal, 34(16), 2147-2161 (2015-07-01)
Endocytosis controls many functions including nutrient uptake, cell division, migration and signal transduction. A clathrin- and caveolin-independent endocytosis pathway is used by important physiological cargos, including interleukin-2 receptors (IL-2R). However, this process lacks morphological and dynamic data. Our electron microscopy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service