Skip to Content
Merck
All Photos(1)

Key Documents

EHU093191

Sigma-Aldrich

MISSION® esiRNA

targeting human CSNK1A1, CTB-89H12.4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGTGGAGAAATTGTGCATATGCCAATTTTTTGTTAAAACCTTTTGTTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTTAAATGCTCACAATTGTGCATTCTTAGGGTTTTTCCATCCCTGGGGTTTGCAAGTTGTTCACTTAAAACATTCTTAAAATGGTTGGCTTCTTGTCTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATATGAAAGACTCTGCCTGCTTAATTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAACTTAGTGACTACTAGATTATCCTTAGGACTCTGCATTAACTCTATAATGTTCTTGGTATTAAAAAAAAAGCATATTTGTCACAGAAATTT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Luke J Fulcher et al.
EMBO reports, 20(9), e47495-e47495 (2019-07-25)
The concerted action of many protein kinases helps orchestrate the error-free progression through mitosis of mammalian cells. The roles and regulation of some prominent mitotic kinases, such as cyclin-dependent kinases, are well established. However, these and other known mitotic kinases
Xia Liu et al.
Oncogene, 39(1), 176-186 (2019-08-30)
Somatic missense mutations of the CSNK1A1 gene encoding casein kinase 1 alpha (CK1α) occur in a subset of myelodysplastic syndrome (MDS) with del(5q) karyotype. The chromosomal deletion causes CSNK1A1 haplo-insufficiency. CK1α mutations have also been observed in a variety of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service