Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU090561

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nod2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGCCATTCTGGAGGTTTGGCTTCGAGGGAACACATTCTCTTTGGAGGAAATCCAAACACTGAGCTCCAGGGACGCCAGACTCTTGTTGTGATGTCTCCGTTTGTGAGTGGACTGTAGGGGCCTGGACTCTGGAGGCTGAGTAACATCAGGCAGAATCCCTCTGCTACGCAGGGCTGGTTTGCTTTTCTGGATGCAGTATAGTCACCTTCTGTTAGCAGAGAAAGTCACCCCATTGCCGTCTGGAATTGACTTTTCCCGAGGAGTCGTGATGGTTGGTCTTGGTTGTTAACTGCACTGACTTAAGAGAGTCATGAGCCGAGAGGACCGCGTTTCTGCCTCTAAAGAGGATCACCATGCAGAATTAGTGACTGGAAGGGGAAAGGCCCTCACTGCATGTGGGTGACACAATCCTCTCTGGTTGCCCCGTGGGAGGATGATGGAGGAGGAGGAAGACAGGGTATGCTTGCATATGTGAGCATTTCTTCTGAGTGAGGACAGCTGTGGTTGCTGCCCTCATGTTTGAACAGCAGACTCCAGCGTCTTTGGCCATTCAACATGGACCCATCACCAGT

Numéro d'accès Ensembl | souris

ENSMUSG00000055994

Numéro d'accès NCBI

NM_145857

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... NOD2(257632) , Nod2(257632)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ke Ke et al.
The Journal of endocrinology, 235(2), 85-96 (2017-08-06)
Nucleotide-binding oligomerization domain-2 (NOD2) is a pattern recognition receptor of the innate immune system. It interacts with serine-threonine kinases to induce activation of nuclear factor κB (NF-κB), which is important for receptor activator of nuclear factor kappa-B ligand (RANKL) signaling.
Michelle B Landes et al.
Journal of leukocyte biology, 97(6), 1111-1119 (2015-03-25)
M.tb, which causes TB, is a host-adapted intracellular pathogen of macrophages. Macrophage intracellular PRRs, such as NOD proteins, regulate proinflammatory cytokine production in response to various pathogenic organisms. We demonstrated previously that NOD2 plays an important role in controlling the
Sang-Im Lee et al.
Clinical oral investigations, 19(6), 1419-1428 (2014-12-04)
The expression levels of intracellular pyrin domain-containing 3 (NLRP3) and microbial pattern-recognition receptors, such as nucleotide-binding oligomerization domain 2 (NOD2), have been reported in human dental pulp cells (HDPCs) and inflamed dental pulp tissue, but the role of NLRP3 and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique