17-10032

ChIPAb+ Trimethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set, rabbit monoclonal

from rabbit

• Synonyme(s) : H3K36me3, Histone H3 (tri methyl K36), H3 histone family, member T, histone 3, H3, histone cluster 3, H3
• Code UNSPSC : 12352203
• eCl@ss : 32160702
• Nomenclature NACRES : NA.32

Propriétés

• Source biologique: rabbit
• Niveau de qualité: 100
• Forme d'anticorps: purified immunoglobulin
• Clone: monoclonal
• Espèces réactives: human, chicken
• Fabricant/nom de marque: ChIPAb+; Upstate^®
• Technique(s): ChIP: suitable; cell based assay: suitable; dot blot: suitable; immunoprecipitation (IP): suitable; western blot: suitable
• Isotype: IgG
• Numéro d'accès NCBI: NP_003484
• Numéro d'accès UniProt: Q16695
• Conditions d'expédition: dry ice

Description

Description générale

All ChIPAb+ antibodies are individually validated for chromatin precipitation, every lot, every time. Each ChIPAb+ antibody set includes control primers (tested every lot by qPCR) to biologically validate your IP results in a locus-specific context. The qPCR protocol and primer sequences are provided, allowing researchers to validate ChIP protocols when using our antibody in their chromatin context. Each set also includes a negative control antibody to ensure specificity of the ChIP reaction.
The ChIPAb+ Trimethyl-Histone H3 (Lys36) set includes the Trimethyl-Histone H3 (Lys36) antibody, a negative control antibody (normal rabbit IgG), and qPCR primers which amplify a 147 bp region of human BDNF intron. The Trimethyl-Histone H3 (Lys36) and negative control antibodies are supplied in a scalable "per ChIP" reaction size and can be used to functionally validate the precipitation of Trimethyl-Histone H3 (Lys36)-associated chromatin.

Histones are highly conserved proteins that serve as the structural scaffold for the organization of nuclear DNA into chromatin. The four core histones, H2A, H2B, H3, and H4, assemble into an octamer (2 molecules of each). Subsequently, 146 base pairs of DNA are wrapped around the octamer, forming a nucleosome, the basic subunit of chromatin. Histones are modified post-translationally by the actions of enzymes in both the nucleus and cytoplasm. These modifications regulate DNA transcription, repair, recombination, and replication. The most commonly studied modifications are acetylation, phosphorylation, methylation, and ubiquitination. These modifications can alter local chromatin architecture, or recruit trans-acting factors that recognize specific histone modifications (the "histone code" hypothesis). The modifications occur predominantly on the N-terminal and C-terminal tails that extend beyond the nucleosome core particle. Methylation of histone H3 on Lys36 (H3K36me2/3) is tightly associated with actively transcribed genes, and this modification is found primarily within the coding region, suggesting H3K36 methylation is necessary for efficient RNA polymerase II elongation and processivity.

Spécificité

Recognizes Trimethyl-Histone H3 (Lys36), Mr ~17 kDa.

Wide reactivity with other species is expected.

Immunogène

Epitope: Trimethylated Lys36

KLH-conjugated, synthetic peptide containing the sequence ....GVme3KKP…, in which me3K corresponds to human trimethyl-histone H3 (Lys36).

Application

Chromatin Immunoprecipitation:
Sonicated chromatin prepared from HeLa cells (1 X 10⁶ cell equivalents per IP) were subjected to chromatin immunoprecipitation using 2 µg of either Normal rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP A Kit (Cat. # 17-610). Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron as a positive locus, and GAPDH promoter primers as a negative locus (Please see figures). Data is presented as percent input of each IP sample relative to input chromatin for each amplicon and ChIP sample as indicated.
Please refer to the EZ-Magna ChIP A (Cat. # 17-408) or EZ-ChIP (Cat. # 17-371) protocol for experimental details.

Western Blot Analysis and Peptide Inhibition:
Representative lot data.
Recombinant Histone H3 (Catalog # 14-411, lane 1) and chicken Core Histones (Catalog # 13-107, lane 2) were resolved by electrophoresis, transferred to nitrocellulose and probed with antitrimethyl-Histone H3 (Lys36) (1:1000 dilution) or anti-trimethyl-Histone H3 (Lys36) pre-adsorbed with 1mM histone H3 peptides containing the following modifications:
Lane 3: monomethyl-lysine 36
Lane 4: dimethyl-lysine 36
Lane 5: trimethyl-lysine 36
Lane 6: unmodified
Proteins were visualized using a goat anti-rabbit secondary antibody conjugated to HRP and a chemiluminescence detection system. (Please see figures).

Peptide Dot Blot Analysis:
Representative lot data.
A dilution series of Histone H3 peptides containing the following modifications was made:
Column 1: unmodified
Column 2: monomethyl-lysine 36
Column 3: dimethyl-lysine 36
Column 4: trimethyl-lysine 36
2 μL of each dilution was spotted onto a PVDF membrane and probed with antitrimethyl-Histone H3 (Lys36), (1:1000 dilution).
Peptides were visualized using a goat anti-rabbit secondary conjugated to HRP and a chemiluminescence detection system (Please see figures).

Research Category
Epigenetics & Nuclear Function

Research Sub Category
Histones

This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers.

Conditionnement

25 assays per set. Recommended use: ~2 μL of antibody per chromatin immunoprecipitation (dependent upon biological context).

Qualité

Chromatin Immunoprecipitation:
Sonicated chromatin prepared from HeLa cells (1 X 10⁶ cell equivalents per IP) were subjected to chromatin immuno-precipitation using 2 µg of either Normal Rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP^® A Kit (Cat. # 17-610).
Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron (Please see figures).
Please refer to the EZ-Magna ChIP A (Cat. # 17-408) or EZ-ChIP (Cat. # 17-371) protocol for experimental details.

Description de la cible

~17 kDa

Forme physique

Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50 μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Store at -20°C.

Normal Rabbit IgG. One vial containing 125 µg Rabbit IgG in 125 µL of storage buffer containing 0.05% sodium azide. Store at -20°C.

ChIP Primers, BDNF Intron. One vial containing 75 μL of 5 μM of each primer specific for human BDNF intron. Store at -20°C.
FOR: ACCCCAACCTCTAACAGCATTA
REV: TGTCTCTCAGCAGTCTTGCATT

Format: Purified

Protein A purified

Stockage et stabilité

Stable for 1 year at -20°C from date of receipt. Handling Recommendations: Upon first thaw, and prior to removing the cap, centrifuge the vial and gently mix the solution. Aliquot into microcentrifuge tubes and store at -20°C. Avoid repeated freeze/thaw cycles, which may damage IgG and affect product performance. Note: Variability in freezer temperatures below -20°C may cause glycerol containing solutions to become frozen during storage.

Remarque sur l'analyse

Control
Includes negative control rabbit IgG antibody and primers specific for human BDNF Intron.

Informations légales

MAGNA CHIP is a registered trademark of Merck KGaA, Darmstadt, Germany

UPSTATE is a registered trademark of Merck KGaA, Darmstadt, Germany

Clause de non-responsabilité

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Informations sur la sécurité

• Code de la classe de stockage: 10 - Combustible liquids