Skip to Content
Merck
All Photos(1)

Key Documents

EMU074311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fermt2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGAATAGGAAAACTTGTAATAAAACTCCACAGCCATAACAATATTTAACTTTAAAGCTATTGTTTCTTATATGCTGCTTAATAAAGTAAGCTTGAACTTTATTATTTTATCATGATACCTTTTTGCCTTACCAGACCAGTACATATGTGCACTAACAAGCACGATTGTTAATCTGCTGCCTACCTTGATATGCCGTATGTGGACTGTGGAATTCCCAACAGTCCTTAGGGCCACGGAAAGCTGTCACTGACTGACAGTAACCAAACTAAGAAACAAGCCATCTACCAAGCCAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hai-Feng Zhang et al.
Oncotarget, 6(30), 28949-28960 (2015-09-04)
Our previous studies have shown that loss of miR-200b enhances the invasiveness of esophageal squamous cell carcinoma (ESCC) cells. However, whether the miR-200-ZEB1/2-E-cadherin regulatory cascade, a master regulator of epithelial-to-mesenchymal transition (EMT), is involved in the regulation of ESCC invasion
Yu Yu et al.
PloS one, 8(5), e63490-e63490 (2013-05-30)
Kindlin 2, as an integrin-associated protein, is required for myocyte elongation and fusion. However, the association of Kindlin 2 with muscle differentiation-related signaling pathways is unknown. Here, we identified a mechanism that Kindlin 2 regulates myogenic regulatory factors myogenin via
Zhaoli Liu et al.
FEBS letters, 589(15), 2001-2010 (2015-06-04)
Kindlin-2 regulates external to internal cell signaling by interaction with integrins in a process that involves the tyrosine kinase, Src. However, the underlying mechanisms remain elusive. Here we report that Src binds to and phosphorylates Kindlin-2 at Y193. Reciprocally, Kindlin-2-Y193

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service