Skip to Content
Merck
All Photos(1)

Key Documents

EHU145931

Sigma-Aldrich

MISSION® esiRNA

targeting human MARVELD2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTTGCTGGATTAGCTTGGATCACCACCATTATTATTCTGGTTCTTGGCATGTCCATGTATTACCGGACCATTCTTCTGGACTCTAATTGGTGGCCCCTAACTGAATTTGGAATTAACGTTGCCTTGTTTATTTTGTATATGGCCGCAGCCATAGTCTATGTGAATGATACCAACCGAGGTGGCCTCTGCTACTATCCGTTATTTAATACACCAGTGAATGCAGTGTTCTGCCGGGTAGAAGGAGGACAGATAGCTGCAATGATCTTCCTGTTTGTCACCATGATAGTTTATCTCATTAGTGCTTTGGTTTGCCTAAAGTTATGGAGGCATGAGGCAGCTCGGAGACATAGAGAATATATGGAACAACAGGAGATAAATGAGCCATCATTGTCATCGAAAAGGAAAATGTGTGAAATGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Susanne M Krug
Annals of the New York Academy of Sciences, 1397(1), 219-230 (2017-06-13)
The tricellular tight junction (tTJ) is a potential weak point of the paracellular barrier. For solving the proportional contribution of the tTJ, ion conductances and macromolecule permeabilities were analyzed in cell lines of different leakiness. MDCK II, Caco-2, and HT-29/B6
Lawrence C S Tam et al.
Scientific reports, 7, 40717-40717 (2017-01-17)
The juxtacanalicular connective tissue of the trabecular meshwork together with inner wall endothelium of Schlemm's canal (SC) provide the bulk of resistance to aqueous outflow from the anterior chamber. Endothelial cells lining SC elaborate tight junctions (TJs), down-regulation of which
Timothy Smyth et al.
Particle and fibre toxicology, 17(1), 52-52 (2020-10-17)
While exposure to diesel exhaust particles has been linked to aberrant immune responses in allergic diseases such as asthma, little attention has been paid to their effects on the airway epithelial barrier. In this study, we sought to determine the
S M Krug et al.
Mucosal immunology, 11(2), 345-356 (2017-06-15)
In the two inflammatory bowel diseases, ulcerative colitis (UC) and Crohn's disease (CD), altered expression of tight junction (TJ) proteins leads to an impaired epithelial barrier including increased uptake of luminal antigens supporting the inflammation. Here, we focused on regulation
Paul S Cassidy et al.
Molecular therapy. Methods & clinical development, 20, 86-94 (2020-12-31)
Systemic or localized application of glucocorticoids (GCs) can lead to iatrogenic ocular hypertension, which is a leading cause of secondary open-angle glaucoma and visual impairment. Previous work has shown that dexamethasone increases zonula occludens-1 (ZO-1) protein expression in trabecular meshwork

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service