Skip to Content
Merck
All Photos(1)

Key Documents

EHU132881

Sigma-Aldrich

MISSION® esiRNA

targeting human APLNR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCATCATGCTGACCTGTTACTTCTTCATCGCCCAAACCATCGCTGGCCACTTCCGCAAGGAACGCATCGAGGGCCTGCGGAAGCGGCGCCGGCTGCTCAGCATCATCGTGGTGCTGGTGGTGACCTTTGCCCTGTGCTGGATGCCCTACCACCTGGTGAAGACGCTGTACATGCTGGGCAGCCTGCTGCACTGGCCCTGTGACTTTGACCTCTTCCTCATGAACATCTTCCCCTACTGCACCTGCATCAGCTACGTCAACAGCTGCCTCAACCCCTTCCTCTATGCCTTTTTCGACCCCCGCTTCCGCCAGGCCTGCACCTCCATGCTCTGCTGTGGCCAGAGCAGGTGCGCAGGCACCTCCCACAGCAGCAGTGGGGAGAAGTCAGCCAGCTACTCTTCGGGGCACAGCCAGGGGCCCGGCCCCAACATGGGCAAGGGTGGAGAACAGATGCACGAGAAATCCATCCCCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lu Zhou et al.
American journal of physiology. Endocrinology and metabolism, 316(5), E773-E781 (2019-03-13)
Preeclampsia (PE) is a major cause of maternal mortality and morbidity worldwide. Although there has been great progress in the understanding of PE, the exact cause for the disease development is still unclear. Recently, studies showed that genetic deletion of
Weilin Xu et al.
Journal of neuroinflammation, 16(1), 247-247 (2019-12-04)
Neuroinflammation and oxidative stress play important roles in early brain injury following subarachnoid hemorrhage (SAH). This study is the first to show that activation of apelin receptor (APJ) by apelin-13 could reduce endoplasmic reticulum (ER)-stress-associated inflammation and oxidative stress after
Bingyuan Ji et al.
Cellular signalling, 73, 109671-109671 (2020-05-15)
Apelin receptor (APJ) and bradykinin B2 receptor (B2R) play an important role in many physiological processes and share multiple similar characteristics in distribution and functions in the cardiovascular system. We first identified the endogenous expression of APJ and B2R in
Lei Cui et al.
Anti-cancer drugs, 30(9), 940-947 (2019-03-29)
Osteosarcoma is the most common type of bone malignancies with a poor prognosis. In recent years, targeted therapy has shown great potential in the treatment of osteosarcoma, and more effective therapeutic targets for this disease need to be developed. APLNR
Andrew G Masoud et al.
The Journal of clinical investigation, 130(1), 94-107 (2019-11-19)
Sustained, indolent immune injury of the vasculature of a heart transplant limits long-term graft and recipient survival. This injury is mitigated by a poorly characterized, maladaptive repair response. Vascular endothelial cells respond to proangiogenic cues in the embryo by differentiation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service