Skip to Content
Merck
All Photos(2)

Key Documents

EHU114431

Sigma-Aldrich

MISSION® esiRNA

targeting human KRAS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Clinically Viable Gene Expression Assays with Potential for Predicting Benefit from MEK Inhibitors.
Roz Brant et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(6), 1471-1480 (2016-10-14)
Qian Fan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(4), 1311-1324 (2017-11-29)
MicroRNAs (miRNAs) have emerged as major regulators of tumour development and progression in non-small cell lung cancer (NSCLC). However, the role of miR-193a-3p in NSCLC is still unclear. Quantitative RT-PCR was used to detect miR-193a-3p expression levels in NSCLC tumour
Stella Liong et al.
Mediators of inflammation, 2018, 3645386-3645386 (2018-11-08)
Heightened placental inflammation and dysfunction are commonly associated in pregnant obese women compared to their pregnant lean counterparts. The small GTPase superfamily members known as the rat sarcoma viral oncogene homolog (Ras) proteins, in particular, the K-Ras and H-Ras isoforms
Xinquan Liu et al.
International journal of nanomedicine, 14, 6589-6600 (2019-09-10)
The RAS family of oncogenes (KRAS, HRAS, NRAS) are the most frequent mutations in cancers and regulate key signaling pathways that drive tumor progression. As a result, drug delivery targeting RAS-driven tumors has been a long-standing challenge in cancer therapy.
Ping-Chih Hsu et al.
Journal of cellular and molecular medicine, 22(6), 3073-3085 (2018-03-27)
Yes-associated protein (YAP) is a main mediator of the Hippo pathway and promotes cancer development and progression in human lung cancer. We sought to determine whether inhibition of YAP suppresses metastasis of human lung adenocarcinoma in a murine model. We

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service